Alpheus brevipes

Stimpson, 1860 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records79

Data sources6

Biological traits4

DNA specimens12

eDNA detections8

Sources6 archives

Databases and archives Alpheus brevipes's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

OBISOcean Biodiversity Information System20 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS79 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD12 specimens

01Narrative

Alpheus brevipes is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1860 door Stimpson.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max12 m

Depth min0 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus brevipes has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes1

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 80% of positions are identical in every specimen.

Where individuals differ — all 131 variable positions, in barcode order

4Amostly conserved

5Cmostly conserved

10Cmostly conserved

22Cmostly conserved

25Cmostly conserved

31Tmostly conserved

34Gmostly conserved

40Tmostly conserved

46Tmostly conserved

52Amostly conserved

55Gmostly conserved

58Tmostly conserved

61Cmostly conserved

67Gmostly conserved

70Amostly conserved

73Gmostly conserved

74Cmostly conserved

76Gmostly conserved

79Avariable

82Gmostly conserved

85Cmostly conserved

91Gvariable

92Cmostly conserved

94Amostly conserved

97Cmostly conserved

115Cmostly conserved

124Tmostly conserved

127Amostly conserved

130Cmostly conserved

136Cmostly conserved

139Cmostly conserved

157Cmostly conserved

163Cmostly conserved

169Amostly conserved

175Gmostly conserved

181Tmostly conserved

187Cmostly conserved

199Cmostly conserved

202Amostly conserved

205Amostly conserved

208Tmostly conserved

212Cmostly conserved

214Chighly variable

217Amostly conserved

220Amostly conserved

223Cmostly conserved

226Cmostly conserved

229Amostly conserved

235Tmostly conserved

238Cmostly conserved

241Amostly conserved

250Cmostly conserved

259Cmostly conserved

263Cmostly conserved

265Cvariable

268Amostly conserved

274Cmostly conserved

283Cmostly conserved

286Amostly conserved

287Cmostly conserved

292Amostly conserved

298Amostly conserved

301Amostly conserved

302Tmostly conserved

307Amostly conserved

313Amostly conserved

319Cmostly conserved

322Cmostly conserved

325Amostly conserved

328Cmostly conserved

334Amostly conserved

340Cmostly conserved

343Cmostly conserved

346Tmostly conserved

349Tmostly conserved

352Tmostly conserved

355Amostly conserved

361Cmostly conserved

364Gmostly conserved

367Cmostly conserved

370Gmostly conserved

373Gmostly conserved

376Amostly conserved

379Cmostly conserved

382Amostly conserved

385Cmostly conserved

388Tmostly conserved

394Cmostly conserved

400Amostly conserved

415Gmostly conserved

418Amostly conserved

421Cmostly conserved

424Amostly conserved

427Cmostly conserved

428Cmostly conserved

439Cmostly conserved

442Tmostly conserved

445Cmostly conserved

475Chighly variable

478Amostly conserved

484Tmostly conserved

496Amostly conserved

499Amostly conserved

502Cmostly conserved

505Tmostly conserved

508Tmostly conserved

511Amostly conserved

514Cmostly conserved

532Cmostly conserved

536Cmostly conserved

541Amostly conserved

544Cmostly conserved

550Ahighly variable

557Cmostly conserved

559Cmostly conserved

562Cmostly conserved

565Amostly conserved

568Cmostly conserved

574Amostly conserved

580Amostly conserved

+11 more variable positions not shown

TACACTATACTTTATTTTTGGCGCCTGGGCTGGGATAGTTGGCACTGCCCTAAGGCTTCTCATTCGGGCAGAGCTGGGACAGCCCGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)8.7%

Haplotypes6

BINs2

Most divergent pair19.6%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus strenuussame genus17.5%Metalpheus rostratipessame family17.5%Alpheus paralcyonesame genus17.6%Alpheus bellulussame genus17.6%Alpheus obesomanussame genus17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type79 records

Museum / vouchered79

Range

Area of Occupancy AOO140 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 4.5 m · max 20 m · 9 records with depth

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 9

9 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence79

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Honolulu, US	26
Washington, US	16
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
University of Floridalocation not on record	1
Museum für Naturkunde Berlin (Zoological Collections)location not on record	1

5 institutions · 55 of 79 vouchered records shown · 4 without an institution code

09Environmental DNA8 detections

Where the DNA of Alpheus brevipes was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

reef frontouter reef slopesand flat and fringing reef

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.6 °C 23.6–23.6

Seasonal swing summer↔winter3.30 °C

Max temp (day)25.0 °C

Min temp (night)22.4 °C

Precipitation50.7 mm/mo

Air humidity59.7 %

Vapour deficit1,166 Pa

Cloud cover33.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)