Alpheus bouvieri

A.Milne-Edwards, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records325

Data sources6

Biological traits4

DNA specimens12

eDNA detections8

Sources6 archives

Databases and archives Alpheus bouvieri's data was compiled from.

GBIFGlobal Biodiversity Information Facility260 records↗

OBISOcean Biodiversity Information System65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS325 records

Environmental DNA1 datasets · 0 countries8 detections

DNA & barcodingBOLD12 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max5 m

Depth min0 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus bouvieri has left across the world's sequence archives.

At a glance

DNA specimens12

BINs2

Marker genes3

eDNA detections8

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 49 variable positions, in barcode order

76Amostly conserved

94Gmostly conserved

100Amostly conserved

109Gmostly conserved

121Gmostly conserved

154Tmostly conserved

160Gmostly conserved

163Cmostly conserved

166Gmostly conserved

181Cmostly conserved

193Cmostly conserved

196Gmostly conserved

205Amostly conserved

214Amostly conserved

229Gmostly conserved

232Tmostly conserved

235Cmostly conserved

244Amostly conserved

265Gmostly conserved

266Cmostly conserved

277Amostly conserved

284Tmostly conserved

290Tmostly conserved

292Amostly conserved

295Gmostly conserved

304Gmostly conserved

322Gvariable

328Avariable

337Gmostly conserved

349Gmostly conserved

367Tmostly conserved

373Amostly conserved

400Cmostly conserved

428Tmostly conserved

436Avariable

466Amostly conserved

496Amostly conserved

502Gmostly conserved

508Tmostly conserved

535Amostly conserved

536Tmostly conserved

547Gmostly conserved

550Cvariable

571Tmostly conserved

604Amostly conserved

613Tmostly conserved

619Cmostly conserved

625Cmostly conserved

631Avariable

TACTCTATACTTTATTTTCGGAGCCTGGGCCGGTATGGTAGGCACAGCTCTCAGTCTCCTCATTCGAGCTGAACTAGGTCAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.1%

Haplotypes3

BINs2

Most divergent pair7.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus sororsame genus16.9%Alpheus obesomanussame genus17.3%Alpheus hippothoesame genus17.5%Alpheus malleatorsame genus17.8%Alpheus colombiensissame genus17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★COI-PSEUDO

animal barcode

08Occurrence & distribution

Record type325 records

Wild obs. + sensor58

Museum / vouchered243

Other24

Origin

Native1

Range

Area of Occupancy AOO408 km²

Depth

0–200 m sunlit21

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 80 m · 21 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 31≤1 km 9>10 km 6

46 georeferenced · 12 without coordinates

Open the mapobservation + sensor58

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy32% within 1 km

≤100 m 5≤1 km 8≤10 km 21>10 km 7

41 georeferenced · 202 without coordinates

Open the institutions mapphysical evidence243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	75
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	19
Washington, US	19
486location not on record	12
Institut Francais pour l'Etude de la Merlocation not on record	12
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	11
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	10
FCMMlocation not on record	9
	6
Cambridge, US	3
New Haven, US	3
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	2
Paris, FR	2
Universidad del Valle (UniValle)location not on record	2
Brussels, BE	2
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Universidade de Lisboa, Museu Bocagelocation not on record	2
Sistema de Colecciones Biológicas, Escuela de Biología, Universidad de San Carlos de Guatemala location not on record	1
Texas Cooperative Wildlife Collectionlocation not on record	1
Puerto Ayora, EC	1

20 institutions · 194 of 243 vouchered records shown · 13 without an institution code

09Environmental DNA8 detections

Where the DNA of Alpheus bouvieri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)