Alpheus amblyonyx

Chace, 1972 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Alpheidae/Alpheus

At a glance

Occurrence records267

Data sources7

Biological traits4

DNA specimens6

eDNA detections9

Sources7 archives

Databases and archives Alpheus amblyonyx's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility159 records↗

OBISOcean Biodiversity Information System108 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS267 records

Environmental DNA1 datasets · 1 countries9 detections

DNA & barcodingBOLD6 specimens

01Narrative

Alpheus amblyonyx is een garnalensoort uit de familie van de Alpheidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1972 door Chace.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max40 m

Depth min0 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpheus amblyonyx has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes2

eDNA detections9

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P512 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.20%

Haplotypes2

BIN1

Most divergent pair0.20%

Where individuals differ — all 2 variable positions, in barcode order

266Tmostly conserved

359Gmostly conserved

TTATTGGAAATGACCAAATCTACAACGTAATTGTAACAGCCCACGCATTTGTAATAATTTTCTTCATGGTCATACCGATTATAATTGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alpheus platyunguiculatussame genus15.0%Alpheus williamsisame genus15.6%Alpheus colombiensissame genus16.4%Metalpheus rostratipessame family17.2%Brachycarpus biunguiculatussame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type267 records

Wild obs. + sensor73

Museum / vouchered194

Origin

Native14

Range

Area of Occupancy AOO564 km²

Depth

0–200 m sunlit43

200–1000 m twilight1

1–4 km midnight0

>4 km abyssal0

median 35 m · max 212 m · 44 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 5

8 georeferenced · 65 without coordinates

Open the mapobservation + sensor73

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 26≤1 km 23≤10 km 1

50 georeferenced · 144 without coordinates

Open the institutions mapphysical evidence194

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mexico City, MX	41
Texas Cooperative Wildlife Collectionlocation not on record	14
Paris, FR	13
Washington, US	13
Alabama Museum of Natural Historylocation not on record	10
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	7
FCMMlocation not on record	7
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	6
Unidad Multidisciplinaria de Docencia e Investigación, Campus Sisal, Facultad de Ciencias, Universidad Nacional Autónoma de Méxicolocation not on record	5
OVFlocation not on record	4
UM-RSMASlocation not on record	4
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	2
University of Louisiana at Layafette, Zoological Collectionlocation not on record	1
The CB Rhizobium Collectionlocation not on record	1
GEDIPlocation not on record	1
Instituto Oceanográfico del Pacífico, Secretaría de Marinalocation not on record	1
College Station, US	1
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	1
WEST, ATLANTIC-location not on record	1
Mykotektet, National Veterinary Institutelocation not on record	1
WEST, ATLANTIC-, OVFlocation not on record	1
Herzog August Library Wolfenbüttellocation not on record	1
Universidad de Antioquia (UdeA)location not on record	1

23 institutions · 137 of 194 vouchered records shown · 11 without an institution code

09Environmental DNA9 detections

Where the DNA of Alpheus amblyonyx was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.5 °C 27.5–27.5

Seasonal swing summer↔winter3.50 °C

Max temp (day)28.0 °C

Min temp (night)26.7 °C

Precipitation90.3 mm/mo

Air humidity62.6 %

Vapour deficit1,362 Pa

Cloud cover27.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)