Alpaida veniliae

(Keyserling, 1865) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Alpaida

At a glance

Occurrence records1 665

Data sources7

Biological traits13

DNA specimens4

eDNA detections0

Sources7 archives

Databases and archives Alpaida veniliae's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 665 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

World Spider Trait DBMasaryk University13 traits · 8 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements8 literature sources13 traits

Occurrence & distributionGBIF1 665 records

DNA & barcodingBOLD4 specimens

01Narrative

Alpaida veniliae is een spinnensoort in de taxonomische indeling van de wielwebspinnen (Araneidae). Het dier behoort tot het geslacht Alpaida. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1865 door Eugen von Keyserling.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesLoiácono & Margaría 2004Foelix 2011Dias et al. 2010Podgaiski et al. 2013 Vandewalle et al. 2010Cardoso et al. 2011Saavedra et al. 2007Pekár et al. 2012a

Morphometry7

Abdomen length♀5.47·♂3.97 mm

Abdomen width♀3.36·♂2.45 mm

Cephalothorax length♀4.86·♂4.35 mm

Cephalothorax width♀3.81·♂3.47 mm

Femur I length♀4.24·♂3.43 mm

Femur IV length♀4.32·♂4.13 mm

Ocular distance♀1.06·♂0.816 mm

Predation3

Hunting guildorb web

Prey OrderHemiptera

Prey diversity3.52 mm

Ecology2

Circadian activitynocturnal

Microhabitatvegetation

Defence1

PredatorBaeus metazygiae

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpaida veniliae has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P653 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.5%

Haplotypes1

BIN1

Where individuals differ — all 17 variable positions, in barcode order

55Tmostly conserved

56Tmostly conserved

116Gmostly conserved

117Tmostly conserved

118Gmostly conserved

121Avariable

157Gmostly conserved

199Amostly conserved

239Amostly conserved

337Cmostly conserved

349Cvariable

382Cmostly conserved

388Cvariable

532Amostly conserved

565Amostly conserved

637Tmostly conserved

640Gmostly conserved

ATTATATTTGGTATTTGGTGCTTGAGCAGCTATAGTAGGAACAGCAATGAGAGTTTTGATTCGGGTAGAGTTAGGACAGCCAGGGAGGTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parawixia rimosasame family13.8%Wagneriana lechuzasame family14.1%Eriophora fuligineasame family14.4%Parawixia rigidasame family14.7%Cyrtophora citricolasame family15.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 665 records

Wild obs. + sensor1 496

Museum / vouchered167

Other2

Range

Area of Occupancy AOO3 844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 550≤1 km 329≤10 km 165>10 km 50

1 094 georeferenced · 402 without coordinates

Open the mapobservation + sensor1 496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 4≤1 km 32≤10 km 34>10 km 23

93 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence167

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Buenos Aires, AR	91
PUC-RSlocation not on record	33
Museu Paraense Emílio Goeldilocation not on record	24
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	9
Universidad de La Salle (La Salle)location not on record	3
Frankfurt am Main	2
Cambridge, US	1
Tartu, EE	1
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	1

9 institutions · 165 of 167 vouchered records shown · 2 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alpaida veniliae

At a glance

Sources7 archives

Morphometry7

Predation3

Ecology2

Defence1

At a glance

Record type1 665 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 9 geolocated

Record type1 665 records