Alpaida tuonabo — The Life Data

Animalia/Arthropoda/Arachnida/Araneae/Araneidae/Alpaida

At a glance

Occurrence records20

Data sources7

Biological traits2

DNA specimens3

eDNA detections0

Sources7 archives

Databases and archives Alpaida tuonabo's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility20 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

World Spider Trait DBMasaryk University2 traits · 2 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources2 traits

Occurrence & distributionGBIF20 records

DNA & barcodingBOLD3 specimens

01Narrative

Alpaida tuonabo is een spinnensoort in de taxonomische indeling van de wielwebspinnen (Araneidae). Het dier behoort tot het geslacht Alpaida. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1936 door Ralph Vary Chamberlin & Wilton Ivie.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBirkhofer & Wolters 2012Pekár et al. 2012a

Predation2

Prey OrderLepidoptera

Prey diversity3.73 mm

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alpaida tuonabo has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACATTATATTTGGTTTTTGGTGCATGAGCGGCGATGGTCGGGACAGCGATAAGGGTTTTGATTCGTGCTGAGTTGGGACAACCAGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neoscona subfuscasame family15.8%Neoscona nauticasame family15.8%Cryptachaea ripariasame order16.1%Cyclosa trilobatasame family16.4%Eustala californiensissame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type20 records

Wild obs. + sensor17

Museum / vouchered3

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 4≤1 km 4>10 km 1

9 georeferenced · 8 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the institutions mapphysical evidence3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	2
Universidad de La Salle (La Salle)location not on record	1

2 institutions · 3 of 3 vouchered records shown