Alosa agone

(Scopoli, 1786) · species

image placeholder — illustration coming later

Animalia/Chordata/Clupeiformes/Clupeidae/Alosa

At a glance

Occurrence records105

Data sources7

Biological traits7

DNA specimens7

eDNA detections0

Sources7 archives

Databases and archives Alosa agone's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility105 records↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources7 traits

Occurrence & distributionGBIF105 records

DNA & barcodingBOLD7 specimens

01Narrative

Alosa agone is a species of ray-finned fish in the genus Alosa.Freyhof, J. & Kottelat, M. 2008. Alosa agone. In: IUCN 2011. IUCN Red List of Threatened Species. Version 2011.2. <www.iucnredlist.org>. Downloaded on 16 December 2011. It is an endangered species.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAnAgeFishBase

Size & morphology2

Body length42.6 cm

Body mass825 g

⚠ sources differ — AnAge: 825 g · FishBase: 760 g

Life cycle & reproduction1

Max. longevity300 months

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

Uses & economy1

Commercial importancecommercial

Other traits1

Vulnerability32.6

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alosa agone has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

2Cmostly conserved

6Amostly conserved

CCTTTACCTAGTATTTGGTGCCTGAGCAGGGATAGTAGGCACTGCCTTAAGTCTCTTAATCCGAGCCGAACTGAGCCAACCCGGGGCACT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alosa macedonicasame genus1.5%Alosa sapidissimasame genus2.3%Alosa pseudoharengussame genus3.8%Alosa aestivalissame genus4.1%Alosa mediocrissame genus5.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P12S

animal barcodemarker

08Occurrence & distribution

Record type105 records

Wild obs. + sensor30

Museum / vouchered68

Cultivated / captive7

Origin

Native14

Range

Area of Occupancy AOO120 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy21% within 1 km

≤100 m 3≤1 km 3≤10 km 22>10 km 1

29 georeferenced · 1 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8>10 km 3

11 georeferenced · 57 without coordinates

Open the institutions mapphysical evidence68

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the mapnot free-living7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bonn, DE	39
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
	7
FishBaselocation not on record	3
Helsinki, FI	2
Paris, FR	1
Washington, US	1
Istituto Superiore per la Protezione e la Ricerca Ambientalelocation not on record	1

8 institutions · 62 of 68 vouchered records shown · 6 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)