Alophia combustella

Herrich-Schäffer, 1852 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Alophia

At a glance

Occurrence records337

Data sources7

Biological traits0

DNA specimens17

eDNA detections15

Sources7 archives

Databases and archives Alophia combustella's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility337 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF337 records

Environmental DNA1 datasets · 5 countries15 detections

DNA & barcodingBOLD17 specimens

01Narrative

Alophia is a monotypic snout moth genus described by Émile Louis Ragonot in 1893. Its single species, Alophia combustella, was described by Gottlieb August Wilhelm Herrich-Schäffer in 1852. It is found in Spain, Portugal, France, Italy, Sardinia, Sicily, Greece, North Macedonia, Croatia, Hungary, Romania, Ukraine and southern Russia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alophia combustella has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections15

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 65 variable positions, in barcode order

1Tmostly conserved

34Tmostly conserved

43Amostly conserved

67Amostly conserved

82Amostly conserved

85Amostly conserved

127Amostly conserved

130Amostly conserved

133Tmostly conserved

163Tmostly conserved

172Cmostly conserved

181Tmostly conserved

187Tmostly conserved

200Gmostly conserved

202Amostly conserved

205Amostly conserved

238Amostly conserved

278Cmostly conserved

280Tmostly conserved

284Tmostly conserved

286Amostly conserved

287Tmostly conserved

292Cmostly conserved

295Gmostly conserved

298Tmostly conserved

319Amostly conserved

325Amostly conserved

334Amostly conserved

340Tmostly conserved

346Tmostly conserved

347Tmostly conserved

349Amostly conserved

364Tmostly conserved

376Tmostly conserved

379Tmostly conserved

382Amostly conserved

386Cmostly conserved

388Tmostly conserved

394Cmostly conserved

421Tmostly conserved

424Tmostly conserved

433Tmostly conserved

442Cmostly conserved

451Tmostly conserved

478Tmostly conserved

484Tmostly conserved

498Cmostly conserved

517Amostly conserved

526Amostly conserved

529Tmostly conserved

536Tmostly conserved

538Amostly conserved

547Cmostly conserved

553Tmostly conserved

574Amostly conserved

596Tmostly conserved

598Amostly conserved

604Tmostly conserved

613Tmostly conserved

616Cmostly conserved

619Gmostly conserved

625Tmostly conserved

628Tmostly conserved

641Tmostly conserved

643Amostly conserved

TACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACATCTTTAAGTCTTTTAATTCGAGCTGAATTAGGTACACCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes4

BINs2

Most divergent pair9.9%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Dioryctria schuetzeellasame family5.2%Dioryctria zimmermanisame family5.8%Dioryctria contortellasame family5.9%Dioryctria taedivorellasame family5.9%Dioryctria banksiellasame family5.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type337 records

Wild obs. + sensor291

Museum / vouchered38

Other8

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 108≤1 km 59≤10 km 7>10 km 3

177 georeferenced · 114 without coordinates

Open the mapobservation + sensor291

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 4≤10 km 5>10 km 3

12 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZAF-UMUlocation not on record	19
Zürich, CH	11
Research Collection of Kai Berggrenlocation not on record	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1

4 institutions · 33 of 38 vouchered records shown · 5 without an institution code

09Environmental DNA15 detections

Where the DNA of Alophia combustella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map5 countries0

coastal scrub/gardencoastal scrub, large Tamarix

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 19.0–24.7

Seasonal swing summer↔winter15.1 °C

Max temp (day)26.2 °C 21.2–26.6

Min temp (night)18.0 °C 13.7–23.1

Precipitation18.7 mm/mo 10.2–52.2

Air humidity53.2 % 47.1–57.2

Moisture balance-73.2 mm/mo

Vapour deficit1,192 Pa 1,033–1,349

Wind speed4.60 m/s

Cloud cover24.4 % 15.9–34.4

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)