Alopecurus pratensis
speciesAt a glance
Occurrence records481 525
Data sources11
Biological traits143
DNA specimens135
eDNA detections59
Sources11 archives
Databases and archives Alopecurus pratensis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility481 525 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI59 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics135 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources143 traits
Occurrence & distributionGBIF481 525 records
Environmental DNA1 datasets · 12 countries59 detections
DNA & barcodingBOLD · NCBI135 specimens
Genome at a glanceCCDB · GoaT6.2 Gbp
01Narrative
Le Vulpin des prés est une espèce de plantes monocotylédones vivaces de la famille des Poaceae, sous-famille des Pooideae, originaire d'Eurasie. C'est une espèce très commune. En France, on la rencontre dans les prés humides, elle fleurit de mai à juillet.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology23
Leaf length400 mm
Leaf length max300 mm
Leaf mass34.37 mg
Leaf size925 mm²
⚠ sources differ — TRY: 925 mm² · LEDA: 972 mm² · GIFT: 1 088 mm²
Leaf width14 mm
⚠ sources differ — AusTraits: 14 mm · GIFT: 2 mm
Leaf width max2 mm
Leaf width min2 mm
Plant height0.62 m
⚠ sources differ — GIFT: 0.62 m · AusTraits: 0.9 m · LEDA: 0.45 m · USDA: 0.914 m · TRY: 0.35 m
Plant height generative0.6 m
Plant height max1.4 m
Plant height min0.3 m
Seed length2.2 mm
⚠ sources differ — TRY: 2.2 mm · GIFT: 1.2 mm
Seed length max1.2 mm
Seed length min1.2 mm
Seed mass0.783 mg
⚠ sources differ — TRY: 0.783 mg · LEDA: 0.674 mg · GIFT: 0.847 mg
Seed mass max1.21 mg
Seed mass min0.64 mg
Seed volume0.71 mm³
Seed volume max0.71 mm³
Seed volume min0.71 mm³
Seed width0.8 mm
Seed width max0.8 mm
Seed width min0.8 mm
Life cycle & reproduction37
After harvest regrowth rateRapid
Bloom periodSpring
Coppice potentialNo
Deciduousnessevergreen
⚠ sources differ — TRY: evergreen · GIFT: deciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flowering endJun
Flowering startApr
Flowering timennnnnnnnyyyn
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formperennial
Life spanperennial
Lifespan categoryLong
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number45 361
Seed spread rateModerate
Seedling vigorHigh
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateSlow
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment31
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 300 m
Elevation mean1 700 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typecaryopsis
⚠ sources differ — AusTraits: caryopsis · GIFT: nut
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: herb
Growth form USDARhizomatous
Habitat GIFTforest, meadows: wet, rivers
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry29
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceHigh
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementHigh
Fire resistantNo
Fire toleranceMedium
Frost free days min90 days
Leaf C:N ratio18.75 g/g
Leaf c437 mg/g
Leaf dry-matter content (LDMC)311 mg/g
⚠ sources differ — TRY: 311 mg/g · LEDA: 284 mg/g
Leaf n21.79 mg/g
Leaf p2.46 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min18 in
Protein potentialMedium
Salinity toleranceLow
Seed longevity index0
Shade toleranceHigh
Soil pH max8 pH
Soil pH min5.8 pH
Specific leaf area (SLA)21.93 mm²/mg
⚠ sources differ — TRY: 21.93 mm²/mg · LEDA: 23.7 mm²/mg · GIFT: 25.04 mm²/mg
Temperature min-38 °F
Wood density245 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound406 880 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typeone-seeded generative dispersule
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Seeds per fruit101-1000
05DNA & barcoding135 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecurus pratensis has left across the world's sequence archives.
At a glance
DNA specimens135
Marker genes7
GenBank sequences10
eDNA detections59
Countries13
The DNA barcodea real sequence read deposited for this species
AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACA …
Alopecurus pratensis isolate L30_33_size=10 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL4★rbcLa★ITS5★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Alopecurus pratensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size6 229 860 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Alopecurus pratensis6.23 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records14–282n range28median28mode49records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2848×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +11
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt
CCDB · brit-fl — Strelkova, O. Cytologia 8: 468-480 (1938)
CCDB · brit-fl — Sieber, V.K., Murray, B.G. Bot. J. Linn. Soc. 83: 293-310 (1981)
CCDB · brit-fl — Sieber, V.K., Murray, B.G. Bot. J. Linn. Soc. 79: 343-355 (1979)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4575
CCDB · fl-europaea — V. Sorsa, 1962
CCDB · poland — Frey L., Mirek Z. and Mizianty M. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 23, 317-325.
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Rudyka, E. G. 1986. Chromosome numbers in some representatives of the Alliaceae, Fabaceae, Malvaceae, Poaceae families. Bot. Zhurn. 71: 1426–1427.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl — Frey, L., Z. Mirek & M. Mizianty. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 23: 317–325.
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Rapp, K. 1979. Supernumerary chromosomes in Alopecurus pratensis L. 1. A cytological and cytogenetic study in populations and diallele crosses. Hereditas 91: 31–48.
CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1979. The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343–355.
CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1981a. Hybridization between tetraploid species of Alopecurus L. (Poaceae): chromosome behaviour of natural and artifical hybrids. Bot. J. Linn. Soc. 83: 293–310.
CCDB · ipcn-api-dl — Rapp, K. 1980. Supernumerary chromosomes in Alopecurus pratensis L. III. A cytogenetic study of F1 and F2 from A. pratensis X A. pratensis ssp. alpestris in populations and diallele crosses. Hereditas 92: 131–143.
CCDB · book-ipcn72 — MALIK, C.P., & I.S. GROVER. 1972. A high polyploid Echinochloa. Broteria 41: 59-61.
CCDB · book-ipcn72 — ENGELSKJOEN, T., & G. KNABEN. 1971. Chromosome numbers of Scandinavian arctic-alpine plant species. III. Acta Boreal., A, Scientia No. 28: 1-30.
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora (Part 1). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 16.: 1-26.
CCDB · eflora
CCDB · Cave1956 — Love & Love b
CCDB · Cave1963 — Sokol. & Strel. 1962; Sokolovskaya 1962; Gadella & Klip. 1963
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Frey, L., Mirek, Z. & Mizianty, M. (1977). Contribution to the chromosome numbers of Polish vascular plants. Fragmenta Floristica et Geobotanica 23: 317-325
CCDB · CromoCat 2015 — Guzik, M. B. (1984). Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82-86
CCDB · CromoCat 2015 — Kozuharov, S. & Kuzmanov, B. (1970). Cytotaxonomic studies on Bulgarian Gramincae. III. Bull. Inst. Bot. 20: 99-108.
CCDB · CromoCat 2015 — Krogulevich, R. E. (1976a). Rol poliploidii v genesise flory Putorana. In: Flora Putorana, NS.
CCDB · CromoCat 2015 — Laane, M. M. & Lie, T. (1985). Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7-15.
CCDB · CromoCat 2015 — Probatova, N. S., Rudyka, E. G., Seledets, V. P. & Nechaev, V. A. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Rapp, K. (1979). Supernumerary chromosomes in Alopecurus pratensis L. 1. A cytological and cytogenetic study in populations and diallele crosses. Hereditas Genetiskt Arkiv 91: 31-48.
CCDB · CromoCat 2015 — Rudyka, E. G. (1986). Chromosome numbers in some representatives of the Alliaceae, Fabaceae, Malvaceae, Poaceae families. Bot. Žurn. 71: 1426-1427.
CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1979). The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343-355.
CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1981a). Hybridization between tetraploid species of Alopecurus L. (Poaceae): chromosome behaviour of natural and artifical hybrids. Botanical Journal of the Linnean Society 83: 293-310.
CCDB · iapt — IAPT/IOPB Chromosome Data 26
+3 more references
2n 141×CCDB · iapt
CCDB · iapt
n 142×CCDB · book-ipcn67-71 · CCDB · Cave1963
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Meiosis and structural hybridity in some Norwegian plant species. Blyttia 27: 141-173.
CCDB · Cave1963 — Sorsa 1962
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type481 525 records
Wild obs. + sensor463 580
Museum / vouchered14 563
Cultivated / captive1 178
Other2 204
Origin
Native30 035
Introduced365
Range
Area of Occupancy AOO491 792 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 74 638≤1 km 101 129≤10 km 174 451>10 km 1 891
352 109 georeferenced · 111 471 without coordinates
Open the mapobservation + sensor463 580
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 1 019≤1 km 2 442≤10 km 6 013>10 km 990
10 464 georeferenced · 4 099 without coordinates
Open the institutions mapphysical evidence14 563
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy89% within 1 km
≤1 km 85≤10 km 1>10 km 10
96 georeferenced · 1 082 without coordinates
Open the mapnot free-living1 178
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions178 of 324 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 5 276 |
| Moscow State Universitylocation not on record | 633 |
| Helsinki, FI | 570 |
| BFLlocation not on record | 494 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 457 |
| LDlocation not on record | 325 |
| BRNUlocation not on record | 296 |
| Uppsala, SE | 238 |
| Kuopio, FI | 227 |
| Olocation not on record | 172 |
| Salzburg, AT | 171 |
| Oulu, FI | 144 |
| MeiseBGlocation not on record | 137 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 133 |
| Tartu, EE | 131 |
| Uniwersytet Warszawskilocation not on record | 114 |
| Adam Mickiewicz University in Poznańlocation not on record | 101 |
| Oskarshamn, SE | 77 |
| Bergen, NO | 76 |
| Turku, FI | 76 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 75 |
| Görlitz, DE | 73 |
| Bronx, US | 71 |
| Irkutsk State Universitylocation not on record | 68 |
| Jyväskylä, FI | 65 |
| KMNlocation not on record | 64 |
| Museo Entomologico de Leonlocation not on record | 63 |
| Moscow, US | 55 |
| Bern, CH | 52 |
| SLU Artdatabankenlocation not on record | 50 |
| WTUlocation not on record | 49 |
| BDBClocation not on record | 48 |
| Denver, US | 47 |
| TROMlocation not on record | 45 |
| Madison, US | 45 |
| Pullman, US | 44 |
| Berlin, DE | 43 |
| Acadia Universitylocation not on record | 41 |
| Corvallis, US | 40 |
| Karlsruhe, DE | 39 |
| Victoria, CA | 38 |
| Provincia di Livornolocation not on record | 38 |
| South Kensington, GB | 38 |
| GJOlocation not on record | 37 |
| Auckland, NZ | 37 |
| Odawara, JP | 35 |
| Logan, US | 34 |
| Beijing, CN | 32 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 31 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 31 |
| Tallinn, EE | 31 |
| Burlington, US | 31 |
| Nagano City, JP | 31 |
| Barcelona, ES | 30 |
| Chicago, US | 30 |
| Entomological Society of Latvialocation not on record | 30 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 29 |
| Université Lavallocation not on record | 26 |
| University of New Hampshirelocation not on record | 25 |
| Chongqing Museumlocation not on record | 25 |
| Sanda, JP | 24 |
| KIRMlocation not on record | 24 |
| Ann Arbor, US | 23 |
| Wlocation not on record | 23 |
| Mount Annan, AU | 23 |
| TUR-Alocation not on record | 23 |
| St. Paul, US | 22 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 21 |
| Boise, US | 20 |
| Garðabær, IS | 20 |
| Saint Louis, US | 19 |
| Flagstaff, US | 19 |
| Porvoo, FI | 18 |
| Québec, CA | 18 |
| Vancouver, CA | 18 |
| Wellington, NZ | 17 |
| Dresden, DE | 17 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 17 |
| New Haven, US | 16 |
| MAlocation not on record | 16 |
| Porrentruy, CH | 16 |
| Canberra, AU | 16 |
| Davis, US | 15 |
| SVN019location not on record | 15 |
| UGentlocation not on record | 15 |
| Portland, US | 15 |
| 14 | |
| Urumqi, CN | 14 |
| Provo, US | 14 |
| Zürich, CH | 14 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 14 |
| Pocatello, US | 14 |
| Missoula, US | 14 |
| Saint John, CA | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Claremont, US | 13 |
| Frankfurt am Main | 13 |
| BClocation not on record | 13 |
| Green Bay, US | 12 |
| Adelaide, AU | 12 |
| Bend, US | 12 |
| University of Alberta Museumslocation not on record | 12 |
| Christchurch, NZ | 11 |
| Bloomington, US | 11 |
| University of Stellenboschlocation not on record | 11 |
| Oregon State Universitylocation not on record | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Philadelphia, US | 11 |
| Montréal, CA | 11 |
| CJBGlocation not on record | 10 |
| Dekalb, US | 10 |
| DBF-NHMDlocation not on record | 9 |
| Caldwell, US | 9 |
| Cheney, US | 9 |
| Toronto, CA | 9 |
| Arcata, US | 9 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 9 |
| Anchorage, US | 8 |
| Mlocation not on record | 8 |
| Tilburg, NL | 8 |
| Yangling, CN | 8 |
| Tomioka, JP | 8 |
| Glarus, CH | 8 |
| Bozeman, US | 8 |
| Otaru, JP | 8 |
| Royal Botanical Gardenslocation not on record | 7 |
| SIHUlocation not on record | 7 |
| Hobart, AU | 7 |
| Kandalaksha State Nature Reservelocation not on record | 7 |
| Zürich, CH | 7 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Riverside, US | 7 |
| Tula State Universitylocation not on record | 7 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 7 |
| Orem, US | 7 |
| Rovaniemi, FI | 7 |
| Xining, CN | 7 |
| Guangzhou, CN | 7 |
| Wuzhou, CN | 7 |
| Winterthur, CH | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| Pittsburg, US | 6 |
| McWane Science Centerlocation not on record | 6 |
| Salamanca, ES | 6 |
| CASlocation not on record | 6 |
| GZUlocation not on record | 6 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 6 |
| KURAlocation not on record | 6 |
| Rocky Mountain Biological Laboratorylocation not on record | 6 |
| Tromso University Museumlocation not on record | 6 |
| Ashland, US | 6 |
| Chiba, JP | 6 |
| International Salmonella Centre (W.H.O.)location not on record | 6 |
| Kunming, CN | 5 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Albuquerque, US | 5 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 5 |
| Trondheim, NO | 5 |
| Whitehorse, CA | 5 |
| National Institute of Biological Resourceslocation not on record | 5 |
| Philadelphia, US | 5 |
| Durham, US | 5 |
| Toyama, JP | 5 |
| JP | 5 |
| Uniwersytet Jagiellońskilocation not on record | 5 |
| Kew, GB | 5 |
| Shinshu Universitylocation not on record | 5 |
| Uniwersytet Opolskilocation not on record | 5 |
| San Luis Obispo, US | 4 |
| San Isidro, AR | 4 |
| Tsukuba, JP | 4 |
| Tampa, US | 4 |
| Frauenfeld, CH | 4 |
| Kochi, JP | 4 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 4 |
| Ypsilanti, US | 4 |
| Forssa, FI | 4 |
| Chadron, US | 4 |
| Knoxville, US | 4 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 4 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 4 |
| University of Wisconsinlocation not on record | 4 |
| Henderson, US | 4 |
| Hiratsuka City Museumlocation not on record | 4 |
| J.F.Oberlin Universitylocation not on record | 4 |
| Rotorua, NZ | 4 |
| Akita Prefectural Museumlocation not on record | 4 |
| College Park, US | 4 |
| Kingston, US | 3 |
| PRClocation not on record | 3 |
| BSBIlocation not on record | 3 |
| EL PASO, US | 3 |
| Chapel Hill, US | 3 |
| Podgorica, ME | 3 |
| San Angelo, US | 3 |
| Sendai, JP | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Santa Cruz, US | 3 |
| Philadelphia, US | 3 |
| Yukon Universitylocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Millersville, US | 3 |
| BG-NMNHSlocation not on record | 3 |
| Salvador, BR | 3 |
| Sagamihara, JP | 3 |
| Russian Academy of Sciences, Komarov Botanical Institutelocation not on record | 3 |
| Pamplona, ES | 2 |
| Herb. BBGlocation not on record | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Bangkok, TH | 2 |
| Macomb, US | 2 |
| Dhaka, BD | 2 |
| Lausanne, CH | 2 |
| SWlocation not on record | 2 |
| Xiamen, CN | 2 |
| San Diego, US | 2 |
| LINUlocation not on record | 2 |
| Sapporo, JP | 2 |
| Bothell, US | 2 |
| Keene State Universitylocation not on record | 2 |
| Brookings, US | 2 |
| Little Rock, US | 2 |
| Williamsburg, US | 2 |
| Kushiro City Museumlocation not on record | 2 |
| ASUlocation not on record | 2 |
| Vitoria, ES | 2 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 2 |
| SEFlocation not on record | 2 |
| Bourges, FR | 2 |
| Weber State Universitylocation not on record | 2 |
| Durango, US | 2 |
| National Museum Waleslocation not on record | 2 |
| Namur, BE | 2 |
| Tacoma, US | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Whitewater, US | 2 |
| Paris, FR | 2 |
| Nagatoro-machi, Chichibu-gun, JP | 2 |
| Allentown, US | 2 |
| Coimbra, PT | 2 |
| Armidale, AU | 2 |
| Samara National Research Universitylocation not on record | 2 |
| Museum of the Rockieslocation not on record | 2 |
| University of Wisconsinlocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 1 |
| Columbia, US | 1 |
| VALElocation not on record | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Sion, CH | 1 |
| Fairfax, US | 1 |
| Phoenix, US | 1 |
| US | 1 |
| Gijón, ES | 1 |
| National Botanic Garden of Waleslocation not on record | 1 |
| Tokushima, JP | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 1 |
| Arequipa, PE | 1 |
| AUAlocation not on record | 1 |
| Bando, JP | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| GB | 1 |
| INFlocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Urumqi, CN | 1 |
| NTNU University Museum, Department of Natural Historylocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Parkville, AU | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| Yugra State University Biological Collectionlocation not on record | 1 |
| Nijmegen, NL | 1 |
| Staten Island, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 1 |
| nbflocation not on record | 1 |
| Badajoz, ES | 1 |
| Ishikawa Museum of Natural Historylocation not on record | 1 |
| Portland, US | 1 |
| DULlocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Nanjing, CN | 1 |
| Tianjin Natural History Museumlocation not on record | 1 |
| Bureau of Land Management, Medford District Officelocation not on record | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| IDElocation not on record | 1 |
| Santa Barbara, US | 1 |
| Göteborg, SE | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| Grand Junction, US | 1 |
| NMBU:MINAlocation not on record | 1 |
| Jaén, ES | 1 |
| Herbario Universidad de Concepciónlocation not on record | 1 |
| Kirksville, US | 1 |
| CICYTEXlocation not on record | 1 |
| Irvine, US | 1 |
| Granada, ES | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Northridge, US | 1 |
| Brussel, BE | 1 |
| Lanzhou, CN | 1 |
| GINRlocation not on record | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| Fullerton, US | 1 |
| QVMAGlocation not on record | 1 |
| Palmerston North, NZ | 1 |
| Fukushima Universitylocation not on record | 1 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 1 |
| Fulda, DE | 1 |
| València, ES | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
324 institutions · 13 040 of 14 563 vouchered records shown · 1 298 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA59 detections
Where the DNA of Alopecurus pratensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found59
Studies independent surveys1
Countries12
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 59 detections have coordinates
Open the map12 countries0
Pinus jefferyi, Quercus chrysolepis, Poa bul…in meadowy area in car park
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median10.2 °C 5.20–15.4
Seasonal swing summer↔winter15.8 °C
Max temp (day)14.1 °C 10.0–20.4
Min temp (night)7.20 °C -0.9–10.4
Precipitation86.6 mm/mo 46.9–112
Air humidity61.5 % 57.8–67.8
Moisture balance-2.40 mm/mo -52.0–38.7
Vapour deficit476 Pa 361–790
Wind speed3.40 m/s 2.70–4.90
Cloud cover43.7 % 37.8–66.3
CHELSA 1981–2010, ~9 km grid, at location & month of 33 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.