Alopecurus geniculatus
speciesAt a glance
Occurrence records270 073
Data sources11
Biological traits143
DNA specimens97
eDNA detections33
Sources11 archives
Databases and archives Alopecurus geniculatus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility270 073 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics97 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources143 traits
Occurrence & distributionGBIF270 073 records
Environmental DNA1 datasets · 10 countries33 detections
DNA & barcodingBOLD · NCBI97 specimens
Genome at a glanceCCDB · GoaT · NCBI7.3 Gbp
01Narrative
Alopecurus geniculatus, le vulpin genouillé, est une espèce de plantes monocotylédones de la famille des Poaceae, sous-famille des Pooideae, originaire des régions tempérées de l'Ancien Monde. Ce sont des plantes herbacées, vivaces, aux tiges (chaumes) décombantes de 45 cm de long, aux inflorescences en panicules denses, spiciformes.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDAUSDATRYWCVP
Size & morphology26
Inflorescence length max5 cm
Inflorescence length min1 cm
Leaf length150 mm
Leaf length max120 mm
Leaf length min3 mm
Leaf mass8.85 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 260 mm² · GIFT: 260 mm²
Leaf width5.5 mm
⚠ sources differ — AusTraits: 5.5 mm · GIFT: 2 mm
Leaf width max8 mm
Leaf width min2 mm
Plant height0.37 m
⚠ sources differ — GIFT: 0.37 m · AusTraits: 0.4 m · LEDA: 0.2 m · USDA: 0.61 m · TRY: 0.231 m
Plant height generative0.275 m
Plant height max0.6 m
Plant height min0.15 m
Seed length1.59 mm
⚠ sources differ — TRY: 1.59 mm · GIFT: 1.5 mm
Seed length max1.5 mm
Seed length min1.5 mm
Seed mass0.317 mg
⚠ sources differ — TRY: 0.317 mg · LEDA: 0.367 mg · GIFT: 0.428 mg
Seed mass max0.452 mg
Seed mass min0.183 mg
Seed volume0.28 mm³
Seed volume max0.28 mm³
Seed volume min0.28 mm³
Seed width0.8 mm
Seed width max0.8 mm
Seed width min0.8 mm
Life cycle & reproduction38
After harvest regrowth rateSlow
Bloom periodSummer
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: unspecialized
Flower colourgreen
Flower conspicuousNo
Flower length max2.6 mm
Flower length min2 mm
Flowering endAug
Flowering startMay
Flowering timennnnnnnnyyyn
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or annual
Life spanperennial
⚠ sources differ — TRY: Perennial · AusTraits: annual perennial · LEDA: perennials · GIFT: perennial
Lifespan categoryShort
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateSlow
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment30
Active growth periodSpring
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureFine
Fruit colouryellow
Fruit fleshinessdry
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: graminoid
Growth form USDAStoloniferous
Habitat GIFTforest, rivers, roadsides, steppe
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassYes
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry22
Anaerobic toleranceHigh
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceNone
Fertility requirementLow
Fire resistantNo
Fire toleranceNone
Frost free days min100 days
Leaf dry-matter content (LDMC)260 mg/g
⚠ sources differ — TRY: 260 mg/g · LEDA: 212 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max45 in
Precipitation min20 in
Salinity toleranceNone
Seed longevity index0.5
Shade toleranceHigh
Soil pH max7.5 pH
Soil pH min4 pH
Specific leaf area (SLA)19.82 mm²/mg
⚠ sources differ — TRY: 19.82 mm²/mg · LEDA: 28.7 mm²/mg · GIFT: 27.56 mm²/mg
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound560 000 per lb
ToxicityNone
Veneer productNo
Other traits10
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Inflorescencepanicle
Planting density max43 000 per acre
Planting density min19 000 per acre
Seeds per fruit101-1000
Shoot orientationascending
05DNA & barcoding97 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecurus geniculatus has left across the world's sequence archives.
At a glance
DNA specimens97
Marker genes11
GenBank sequences10
eDNA detections33
Countries12
The DNA barcodea real sequence read deposited for this species
AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACA …
Alopecurus geniculatus isolate L18_15size_7 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Alopecurus geniculatus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size7 325 220 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Alopecurus geniculatus7.33 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy4× tetraploid · measured
Chromosome records28–282n range28median28mode40records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2840×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Králik E. & Hrozienčik I., 2000: Karyologické štúdium slovenskej flóry XXXIV. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 43-46.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · brit-fl — Sieber, V.K., Murray, B.G. Bot. J. Linn. Soc. 79: 343-355 (1979)
CCDB · brit-fl — Sieber, V.K., Murray, B.G. Bot. J. Linn. Soc. 83: 293-310 (1981)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae Fernandes, A. & M. Queirs.Bol. Soc. Brot. ser. 243: 20-140(1969).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4576
CCDB · fl-europaea — Johnsson, 1941
CCDB · poland — Frey L., Mirek Z. and Mizianty M. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Flor. Geobot. 23, 317-325.
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Pogan, E. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 24: 159–189.
CCDB · ipcn-api-dl — Frey, L., Z. Mirek & M. Mizianty. 1977. Contribution to the chromosome numbers of Polish vascular plants. Fragm. Florist. Geobot. 23: 317–325.
CCDB · ipcn-api-dl — Probatova, N. S., A. P. Sokolovskaya & E. G. Rudyka. 1989. Chromosome numbers in some species of vascular plants from Kunashir Island (the Kuril Islands). Bot. Žhurn. (Moscow & Leningrad) 74: 1675–1678.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya. 1996. Chromosome numbers in synanthropic plants from the Russian Far East. Bot. Žhurn. (Moscow & Leningrad) 81(5): 98–101.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1979. The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343–355.
CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1981a. Hybridization between tetraploid species of Alopecurus L. (Poaceae): chromosome behaviour of natural and artifical hybrids. Bot. J. Linn. Soc. 83: 293–310.
CCDB · book-ipcn67-71 — TAYLOR, R.L., & G.A. MULLIGAN. 1968. Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. Queen's Printer, Ottawa. pp. 148.
CCDB · book-ipcn67-71 — FERNANDES, A . & M. QUEIROS. 1969. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brat. 43(ser.2l: 3-140.
CCDB · book-atlas-flowering-plants — Avdulov 1928
CCDB · kew — Band SR. (pers. comm. 1984).
CCDB · Cave1956 — Love & Love b
CCDB · Cave1957 — Bosemark
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Fernandes, A. & Queirós, M. (1969). Contribution à la connaissance cytotaxinomique des spermatophyta du Portugal. I. Gramineae. Bol. Soc. Brot. 43: 20-140.
CCDB · CromoCat 2015 — Frey, L., Mirek, Z. & Mizianty, M. (1977). Contribution to the chromosome numbers of Polish vascular plants. Fragmenta Floristica et Geobotanica 23: 317-325
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
CCDB · CromoCat 2015 — Lövkvist, B. & Hultgård, U.-M. (1999). Chromosome numbers in south Swedish vascular plants Opera botanica 137: 1-42
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1988a). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika.
Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfe
CCDB · CromoCat 2015 — Pogan, E., H. Wcislo, R. Izmailov, L. Przywara. (1982a). Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov., Ser. Bot. 26: 159-189.
CCDB · CromoCat 2015 — Probatova, N. S., A. P. Sokolovskaya & E. G. Rudyka. (1989). Chromosome numbers in some species of vascular plants from Kunashir Island (the Kuril Islands). Bot. Žurn. 74: 1675-1678.
CCDB · CromoCat 2015 — Probatova, N. S., E. G. Rudyka & A. P. Sokolovskaya (1996). Chromosome numbers in synanthropic plants fromt he Russian Far East. Bot. Zhurn. 81(5): 98-101
CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1979). The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343-355.
CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1981a). Hybridization between tetraploid species of Alopecurus L. (Poaceae): chromosome behaviour of natural and artifical hybrids. Botanical Journal of the Linnean Society 83: 293-310.
CCDB · iapt — IAPT/IOPB Chromosome Data 32
n 74×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Mehra, P. N. 1982. Cytology of East Indian grasses. ý.
CCDB · book-ipcn73-74 — MEHRA, P.N., & O.P. SOOD. 1974. In IOPB chromosome number reports XLVI. Taxon 23: 801-812.
CCDB · CromoCat 2015 — Mehra, P. N. & O. P. Sood. (1974). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XLVI]. Taxon 23(5/6): 807-808.
CCDB · CromoCat 2015 — Mehra, P. N. (1982). Cytology of East Indian grasses
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness99.4% BUSCO
08Occurrence & distribution
Record type270 073 records
Wild obs. + sensor260 568
Museum / vouchered9 144
Cultivated / captive50
Other311
Origin
Native25 865
Introduced524
Range
Area of Occupancy AOO326 932 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy56% within 1 km
≤100 m 53 652≤1 km 59 143≤10 km 89 448>10 km 589
202 832 georeferenced · 57 736 without coordinates
Open the mapobservation + sensor260 568
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 539≤1 km 1 548≤10 km 2 614>10 km 1 017
5 718 georeferenced · 3 426 without coordinates
Open the institutions mapphysical evidence9 144
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 14
15 georeferenced · 35 without coordinates
Open the mapnot free-living50
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions143 of 255 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 160 |
| Helsinki, FI | 621 |
| Olocation not on record | 443 |
| LDlocation not on record | 411 |
| Uppsala, SE | 277 |
| Moscow State Universitylocation not on record | 267 |
| Trondheim, NO | 210 |
| BFLlocation not on record | 198 |
| MeiseBGlocation not on record | 181 |
| Tartu, EE | 155 |
| Oulu, FI | 139 |
| Kuopio, FI | 138 |
| Turku, FI | 134 |
| Bergen, NO | 131 |
| BRNUlocation not on record | 125 |
| TROMlocation not on record | 122 |
| Bronx, US | 119 |
| Museo Entomologico de Leonlocation not on record | 113 |
| Oskarshamn, SE | 108 |
| Garðabær, IS | 104 |
| Adam Mickiewicz University in Poznańlocation not on record | 98 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 95 |
| KMNlocation not on record | 79 |
| SLU Artdatabankenlocation not on record | 78 |
| Mount Annan, AU | 76 |
| Flagstaff, US | 75 |
| Philadelphia, US | 67 |
| Chicago, US | 62 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 59 |
| MAlocation not on record | 57 |
| Adelaide, AU | 55 |
| Canberra, AU | 54 |
| Uniwersytet Warszawskilocation not on record | 51 |
| WTUlocation not on record | 51 |
| CJBGlocation not on record | 50 |
| Corvallis, US | 50 |
| Pullman, US | 49 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 49 |
| South Kensington, GB | 48 |
| Entomological Society of Latvialocation not on record | 47 |
| Acadia Universitylocation not on record | 46 |
| Auckland, NZ | 45 |
| Tallinn, EE | 44 |
| Jyväskylä, FI | 44 |
| Victoria, CA | 41 |
| Görlitz, DE | 41 |
| Bern, CH | 40 |
| Provincia di Livornolocation not on record | 40 |
| Salzburg, AT | 37 |
| Vancouver, CA | 37 |
| Wellington, NZ | 36 |
| 32 | |
| Madison, US | 31 |
| BIO-UNIPIlocation not on record | 30 |
| LfUlocation not on record | 29 |
| Christchurch, NZ | 28 |
| Moscow, US | 28 |
| Logan, US | 28 |
| TUR-Alocation not on record | 27 |
| Davis, US | 25 |
| Brisbane, AU | 25 |
| Hobart, AU | 24 |
| Berlin, DE | 23 |
| CASlocation not on record | 21 |
| DBF-NHMDlocation not on record | 20 |
| Saint Louis, US | 20 |
| Claremont, US | 18 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 17 |
| Barcelona, ES | 17 |
| Dresden, DE | 17 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 16 |
| Wlocation not on record | 16 |
| UGentlocation not on record | 15 |
| John May Museum of Natural Historylocation not on record | 15 |
| Taipei, TW | 15 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| University of Alberta Museumslocation not on record | 14 |
| Uniwersytet Jagiellońskilocation not on record | 14 |
| Philadelphia, US | 14 |
| Wuzhou, CN | 13 |
| Salamanca, ES | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| ASUlocation not on record | 12 |
| Ann Arbor, US | 12 |
| Université Lavallocation not on record | 12 |
| GJOlocation not on record | 12 |
| University of Stellenboschlocation not on record | 11 |
| Missoula, US | 11 |
| Chongqing Museumlocation not on record | 11 |
| Zürich, CH | 11 |
| BDBClocation not on record | 11 |
| Mlocation not on record | 11 |
| Oregon State Universitylocation not on record | 10 |
| Porvoo, FI | 10 |
| Bloomington, US | 10 |
| València, ES | 10 |
| Arcata, US | 9 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 9 |
| New Haven, US | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Caldwell, US | 8 |
| NSW Dept of Planning, Industry and Environmentlocation not on record | 8 |
| Toronto, CA | 8 |
| Armidale, AU | 8 |
| SZUlocation not on record | 8 |
| Museo Achille Folettolocation not on record | 8 |
| University of New Hampshirelocation not on record | 8 |
| Saint John, CA | 8 |
| BClocation not on record | 8 |
| Tilburg, NL | 7 |
| Green Bay, US | 7 |
| Stockholm, SE | 7 |
| Frankfurt am Main | 7 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 7 |
| Porrentruy, CH | 7 |
| Portland, US | 7 |
| Fulda, DE | 7 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| Lausanne, CH | 6 |
| Vitoria, ES | 6 |
| Kensington, AU | 6 |
| Angwin, US | 6 |
| Paris, FR | 6 |
| Phoenix, US | 6 |
| Riverside, US | 6 |
| Parkville, AU | 6 |
| Xiamen, CN | 6 |
| Bozeman, US | 6 |
| Rovaniemi, FI | 5 |
| Provo, US | 5 |
| Namur, BE | 5 |
| State Herbarium of South Australialocation not on record | 5 |
| Bourges, FR | 5 |
| Burlington, US | 5 |
| Zürich, CH | 5 |
| Royal Botanic Garden Edinburghlocation not on record | 5 |
| John T. Waterhouse Herbariumlocation not on record | 5 |
| Madrid, ES | 5 |
| Boise, US | 5 |
| Albuquerque, US | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Tromso University Museumlocation not on record | 4 |
| nbflocation not on record | 4 |
| Ashland, US | 4 |
| Forssa, FI | 4 |
| Rotorua, NZ | 4 |
| Denver, US | 4 |
| National Museum Waleslocation not on record | 3 |
| GZUlocation not on record | 3 |
| USFSlocation not on record | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Karlsruhe, DE | 3 |
| College Park, US | 3 |
| PRClocation not on record | 3 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| Tacoma, US | 3 |
| Pamplona, ES | 3 |
| Alicante, ES | 3 |
| Herb. BBGlocation not on record | 3 |
| Fullerton, US | 3 |
| Montréal, CA | 3 |
| Chadron, US | 3 |
| Philadelphia, US | 3 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 3 |
| San Luis Obispo, US | 3 |
| Chicago, US | 3 |
| Québec, CA | 2 |
| ISAlocation not on record | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Tula State Universitylocation not on record | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Winterthur, CH | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Granada, ES | 2 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Yaoundé, CM | 2 |
| Anchorage, US | 2 |
| Nijmegen, NL | 2 |
| Brussel, BE | 2 |
| NMBU:MINAlocation not on record | 2 |
| McWane Science Centerlocation not on record | 2 |
| San Diego, US | 2 |
| Pocatello, US | 2 |
| Portland, US | 2 |
| Whitehorse, CA | 2 |
| Coimbra, PT | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Tampa, US | 2 |
| Bend, US | 2 |
| BSBIlocation not on record | 2 |
| Henderson, US | 2 |
| La Trobe Universitylocation not on record | 2 |
| Columbia, US | 2 |
| Kew, GB | 2 |
| Dekalb, US | 2 |
| San Jose, US | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Royal British Columbia Museumlocation not on record | 1 |
| Los Angeles, US | 1 |
| Spearfish, US | 1 |
| San Angelo, US | 1 |
| Bothell, US | 1 |
| Aarhus, DK | 1 |
| Centro de Investigación Regional Norte Centro, Campo Experimental La Campana, Instituto Nacional de Investigaciones Forestales, Agrícolas y Pecuariaslocation not on record | 1 |
| No collectionlocation not on record | 1 |
| Uberlândia, BR | 1 |
| St. Paul, US | 1 |
| Podgorica, ME | 1 |
| Bangkok, TH | 1 |
| nlocation not on record | 1 |
| Clemson, US | 1 |
| Staten Island, US | 1 |
| Samara National Research Universitylocation not on record | 1 |
| National Institute of Biological Resourceslocation not on record | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| Cheney, US | 1 |
| US | 1 |
| Mississippi State, US | 1 |
| Tuscaloosa, US | 1 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| San Isidro, AR | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Santa Barbara, US | 1 |
| Boumlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Beijing, CN | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| FLADlocation not on record | 1 |
| Fort Worth, US | 1 |
| H-AkrKGlocation not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| ULBF-AGRlocation not on record | 1 |
| Millersville, US | 1 |
| QVMAGlocation not on record | 1 |
| Sevilla, ES | 1 |
| Smithfield, AU | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Palmerston, AU | 1 |
| Arequipa, PE | 1 |
| Kandalaksha State Nature Reservelocation not on record | 1 |
| CICYTEXlocation not on record | 1 |
| Naturkundliche Sammlung Urilocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Pretoria, ZA | 1 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 1 |
255 institutions · 8 145 of 9 144 vouchered records shown · 861 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA33 detections
Where the DNA of Alopecurus geniculatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found33
Studies independent surveys1
Countries10
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 33 detections have coordinates
Open the map10 countries0
in dried up artificial pond
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.6 °C 8.40–17.6
Seasonal swing summer↔winter15.3 °C
Max temp (day)15.2 °C 9.80–22.1
Min temp (night)9.10 °C 4.60–13.4
Precipitation79.2 mm/mo 23.3–123
Air humidity61.9 % 51.6–67.4
Moisture balance-4.30 mm/mo -75.8–71.2
Vapour deficit551 Pa 379–818
Wind speed4.10 m/s 2.50–5.80
Cloud cover41.2 % 14.1–64.1
CHELSA 1981–2010, ~9 km grid, at location & month of 28 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.