Alopecurus bulbosus

Gouan · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Poaceae/Alopecurus

At a glance

Occurrence records6 552

Data sources10

Biological traits29

DNA specimens4

eDNA detections3

Sources10 archives

Databases and archives Alopecurus bulbosus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 552 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources29 traits

Occurrence & distributionGBIF6 552 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB · GoaT2n = 14

01Narrative

Le Vulpin bulbeux est une plante du genre Alopecurus et de la famille des Poaceae (graminées).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology8

Leaf size32 mm²

Plant height0.275 m

⚠ sources differ — GIFT: 0.275 m · LEDA: 0.275 m · TRY: 0.45 m

Plant height generative0.4 m

Plant height max0.4 m

Plant height min0.1 m

Seed mass0.46 mg

Seed mass max0.46 mg

Seed mass min0.45 mg

Life cycle & reproduction11

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Dispersal typeanimal

Flowering endJul

Flowering startMay

Life formperennial

Life spanperennial

Pollination modeabiotic

Pollination syndromewind

Raunkiær life formhemicryptophyte

Reproduction asexualabsent

Seed number963

Diet & foraging2

Carnivorynon-carnivorous

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: graminoid

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit with appendage

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecurus bulbosus has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes2

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLJN893324.1 ↗498 bpUnited Kingdom · 1983

ACGT

AAGTGTTGGATTTCAAGCTGGTGTTAAAGATTATAAATTGACTTACTACACCCCGGAGTATGAAACCAAGGATACTGATATCTTGGCAGC …

Alopecurus bulbosus isolate NMW3175 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Alopecurus bulbosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–282n range14median14mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1416×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · brit-fl · CCDB · nw-europe-fl +5

GoaT · DTOL Flowering Plants Estimates Kew

CCDB · brit-fl — Maude, P.F. New Phytol. 38: 1-31 (1939)

CCDB · brit-fl — Sieber, V.K., Murray, B.G. Bot. J. Linn. Soc. 79: 343-355 (1979)

CCDB · brit-fl — Sieber, V.K., Murray, B.G. Bot. J. Linn. Soc. 81: 293-300 (1980)

CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4577

CCDB · fl-europaea — Maude, 1940

CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1981. Structural and numerical chromosomal polymorphism in natural populations of Alopecurus (Poaceae). Pl. Syst. Evol. 139: 121–136.

CCDB · book-ipcn67-71 — 66-104

CCDB · book-atlas-flowering-plants — Maude 1940

CCDB · CromoCat 2015 — Gadella, Th. W. J. & Kliphuis, E. (1966). Chromosome numbers of flowering plants in the Netherlands. II. K. Akad. Wetenschap. Amsterdam Proc., Ser. C, 69. 5: 541-556

CCDB · CromoCat 2015 — Hubbard, C. E. (1954). Grasses. A guide to their structure, identification, uses, and distribution in the British Isles. Hardmondsworth, Middlesex, Penguin books Ltd. 1-428

CCDB · CromoCat 2015 — Johnsson, H. (1941). Cytological studies in the genus Alopecurus. Acta Univ. Lunds. 3: 1-43

CCDB · CromoCat 2015 — Maude, P. F. (1939). The Merton catalogue. A list of the chromosome numerals of species of British flowering plants. New Phytol. 38: 1-31.

CCDB · CromoCat 2015 — Maude, P. F. (1940). Chromosome numbers in some British plants. New Phytol. 39: 17-32.

CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1979). The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343-355.

CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1981b). Structural and numerical chromosomal polymorphism in natural populations of Alopecurus (Poaceae). Plant Systematics and Evolution 139: 121-136.

2n 282×CCDB · ipcn-api-dl · CCDB · CromoCat 2015

CCDB · ipcn-api-dl — Wentworth, J. E. 2004. An assessment of the origin of Alopecurus geniculatus L. based on 2C DNA amounts, NOR sites, RAPDs and cpDNA analysis. Watsonia 25: 137–155.

CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1979). The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343-355.

2n 211×CCDB · CromoCat 2015

CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1979). The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343-355.

n 71×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — DELAY, J. 1969. Ecotypes de stations maritimes. Inf. Ann. Caryosyst. et Cytogenet. 3: 21-23.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type6 552 records

Wild obs. + sensor5 954

Museum / vouchered549

Other49

Origin

Native744

Introduced3

Range

Area of Occupancy AOO7 668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy32% within 1 km

≤100 m 832≤1 km 724≤10 km 3 270>10 km 108

4 934 georeferenced · 1 020 without coordinates

Open the mapobservation + sensor5 954

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 40≤10 km 61>10 km 4

105 georeferenced · 444 without coordinates

Open the institutions mapphysical evidence549

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BIO-UNIPIlocation not on record	71
MeiseBGlocation not on record	23
South Kensington, GB	19
Brussel, BE	17
BDBClocation not on record	13
Institut und Museum fuer Geologie und Palaeontologielocation not on record	11
BClocation not on record	8
CJBGlocation not on record	6
Dresden, DE	5
BSBIlocation not on record	3
MAlocation not on record	3
Wlocation not on record	3
Auckland, NZ	2
National Museum Waleslocation not on record	2
Vitoria, ES	2
Berlin, DE	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Görlitz, DE	1
Podgorica, ME	1
Bloomington, US	1
Québec, CA	1
Barcelona, ES	1
Zürich, CH	1
Pamplona, ES	1
Oskarshamn, SE	1
BRNUlocation not on record	1
Arequipa, PE	1
Natural History Museum Rotterdamlocation not on record	1
Tilburg, NL	1
Monastir, TN	1
Paris, FR	1
Universität Tübingenlocation not on record	1
Bourges, FR	1
GZUlocation not on record	1

34 institutions · 209 of 549 vouchered records shown · 338 without an institution code

09Environmental DNA3 detections

Where the DNA of Alopecurus bulbosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.9 °C 11.4–16.5

Seasonal swing summer↔winter11.9 °C

Max temp (day)17.1 °C 14.3–20.0

Min temp (night)10.2 °C 8.00–12.4

Precipitation73.2 mm/mo 64.9–81.5

Air humidity62.0 % 61.0–63.0

Vapour deficit635 Pa 527–744

Cloud cover48.7 % 48.7–48.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alopecurus bulbosus

At a glance

Sources10 archives

Size & morphology8

Life cycle & reproduction11

Diet & foraging2

Habitat & environment6

Physiology & chemistry1

Other traits1

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type6 552 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions19 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 552 records