Alopecurus arundinaceus
Poir. · speciesAt a glance
Occurrence records8 775
Data sources12
Biological traits112
DNA specimens59
eDNA detections27
Sources12 archives
Databases and archives Alopecurus arundinaceus's data was compiled from.
WikipediaWikimedia Foundation8 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility8 775 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI27 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics59 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources112 traits
Occurrence & distributionGBIF8 775 records
Environmental DNA1 datasets · 5 countries27 detections
DNA & barcodingBOLD · NCBI59 specimens
Genome at a glanceCCDB2n = 28
01Narrative
Alopecurus arundinaceus, the creeping meadow foxtail or creeping foxtail, is a rhizomatous perennial species in the Grass family (Poaceae). Native to Eurasia and northern Africa, and widely introduced elsewhere, this sod forming grass is useful as a forage and for erosion control.USDA NCRS Plant Guide: Alopecurus arundinaceus Retrieved 2010-03-24. It grows in damp or saline grasslands and banks of waterways, and on mountains up to 1,200 m. It flowers between April and July, depending on its location.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology7
Plant height0.767 m
⚠ sources differ — GIFT: 0.767 m · LEDA: 0.625 m · USDA: 0.914 m · TRY: 0.914 m
Plant height generative0.95 m
Plant height max0.8 m
Plant height min0.6 m
Seed mass0.576 mg
⚠ sources differ — TRY: 0.576 mg · LEDA: 0.428 mg · GIFT: 0.521 mg
Seed mass max0.7 mg
Seed mass min0.3 mg
Life cycle & reproduction33
After harvest regrowth rateRapid
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessevergreen
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flower colouryellow
Flower conspicuousNo
Flowering endJul
Flowering startMay
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryModerate
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
Resprout abilityNo
Seed spread rateModerate
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateRapid
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 100 m
Elevation mean3 000 m
Elevation min300 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureFine
Fruit colourblack
Growth formherb
Growth form USDARhizomatous
Habitat GIFTirrigation channals, meadows, rivers, swamps
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min12 in
Shape and orientationErect
Small grainNo
Woodinessnon-woody
Physiology & chemistry21
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceMedium
Cold stratification requiredNo
Drought toleranceMedium
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min30 days
Leaf dry-matter content (LDMC)293 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min18 in
Protein potentialHigh
Salinity toleranceHigh
Shade toleranceHigh
Soil pH max8.4 pH
Soil pH min5.5 pH
Temperature min-43 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalHigh
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound786 064 per lb
ToxicityNone
Veneer productNo
Other traits6
Diaspore typefruit with appendage
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
Shoot orientationprostrate
05DNA & barcoding59 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecurus arundinaceus has left across the world's sequence archives.
At a glance
DNA specimens59
Marker genes7
GenBank sequences10
eDNA detections27
Countries11
The DNA barcodea real sequence read deposited for this species
AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACC …
Alopecurus arundinaceus isolate 12-G-22(2) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL★rbcLa★ITS9★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Alopecurus arundinaceus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidypolyploid inferred
Chromosome records14–282n range28median28mode39records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2836×CCDB · iapt · CCDB · iber-fl · CCDB · fl-europaea +5
CCDB · iapt — IAPT/IOPB Chromosome Data 5
CCDB · iber-fl — Cytotaxonomy of spanish plants. II. Monocotyledons. Lve, A. & E. Kjellqvist.Lagascalia3(2): 147-182(1973).
CCDB · fl-europaea — Johnsson, 1941
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Krogulevich, R. E. 1978. Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19–48. Nauka, Novosibirsk.
CCDB · ipcn-api-dl — Sorokin, S. N. 1990. Chromosome numbers in members of the Poaceae family from the north-west of the European part of the USSR. Bot. Žhurn. (Moscow & Leningrad) 75: 1185.
CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.
CCDB · ipcn-api-dl — Ko|3zuharov, S. I. & A. V. Petrova. 1991. Chromosome numbers of Bulgarian angiosperms. Fitologija 39: 72–77.
CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1979. The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343–355.
CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1981a. Hybridization between tetraploid species of Alopecurus L. (Poaceae): chromosome behaviour of natural and artifical hybrids. Bot. J. Linn. Soc. 83: 293–310.
CCDB · ipcn-api-dl — Engelskjon, T. 1979. Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1–38.
CCDB · book-ipcn73-74 — LOEVE, A., & E. KJELLQVIST. 1973. Cytotaxonomy of Spanish plants. Monocotyledons. Lagascalia 3: 14 7-182. I
CCDB · book-indian_vol2 — Love, A. & Love, D. 1948 ; Mehra, P .N. & Remanandan, P. 1973a ; Mehra, P.N. & Sharma, M.L. 1977; Humphries, C.J. et al. 1980
CCDB · book-indian_vol2 — Strelkova, o.s. (Fedorov); Sokolovskaya, A.P. & Strelkova, O.S. (Fedorov)
CCDB · eflora
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Korobkov, A. A., Kotseruba, V. V., Probatova, N. S. & Gnutikov, A. A.
Nina S. Probatova2* & Aleksandr A. Gnutikov1 (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:895-897
CCDB · CromoCat 2015 — Chepinoga, V. V., Gnutikov, A. A., Enushchenko, I. V. & Chepinoga, A. V. (2008). IAPT/IOPB Chromosome Data 6 Taxon 57(4): 1267-1273
CCDB · CromoCat 2015 — Chopanov, P. & Yurtsev, B. (1976). Chromosome numbers of some grasses of Turkmenia. II. Bot. Žurn. 61: 1240-1244.
CCDB · CromoCat 2015 — Engelskjon, T. (1979). Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1-38.
CCDB · CromoCat 2015 — Johnsson, H. (1941). Cytological studies in the genus Alopecuros. Acta Univ. Lunds. 37: 1-44.
CCDB · CromoCat 2015 — Kozuharov, S. & Petrova, A. (1991). Chromosome numbers of Bulgarian Angiosperms. Fitologija 39: 72-77.
CCDB · CromoCat 2015 — Krasnikov, A. A. (1991). Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žurn. 76: 476-479.
CCDB · CromoCat 2015 — Krogulevich, R. E. (1978a). Kariologicheskij analiz vidov flory Vostochnogo Sajana. V Flora Pribajkal'ja. 19-48. Nauka, Novosibirsk.
CCDB · CromoCat 2015 — Löve, A. & Kjellqvist, E. (1973). Cytotaxonomy of Spanish plants. II. Monocotyledons. Lagascalia 3(2): 147-182.
CCDB · CromoCat 2015 — Probatova, N. S., Seledets, V. P. & Rudyka, E. G. (2008). IAPT/IOPB Chromosome Data 5 Taxon 57(2): 553-562
CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1979). The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343-355.
CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1981a). Hybridization between tetraploid species of Alopecurus L. (Poaceae): chromosome behaviour of natural and artifical hybrids. Botanical Journal of the Linnean Society 83: 293-310.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & N. S. Probatova. (1977). Karyological investigation of grasses (Poaceae) in southern part of the Soviet far east. Bot. Žurn. 62: 1143-1153.
CCDB · CromoCat 2015 — Sokolovskaya, A. P. & O. S. Strelkova. (1948b). Geograficheskoye raspredelenie poliploidov. III. Issledovanieflory al'piyskoj oblasti tsentral'novo kavkazskovo chrebta. Ucen. Zap. Leningradsk. Gosud. Univ., Ser. Biol. Nauk. 66: 195-216.
CCDB · CromoCat 2015 — Sorokin, S.N. (1990). Chromosome numbers in members of the Poaceae family from the north-west of the European part of the USSR. Bot. Zurn. 75:1185
CCDB · CromoCat 2015 — Strelkova, O. (1938). Polyploidy and geographo systematic groups in the genus Alopecuros L. Cytologia 8: 468-480.
CCDB · CromoCat 2015 — Probatova, N.S., Seledets, V.P., Rudyka, E.G., Gnutikov, A.A., Kozhevnikova, Z.V. & Barkalov V.Y. (2009). IAPT/IOPB Chromosome Data 8 Taxon 58 (4): 1284-1288
CCDB · iapt — IAPT/IOPB Chromosome Data 26
CCDB · iapt — IAPT/IOPB Chromosome Data 27
CCDB · iapt — IAPT/IOPB Chromosome Data 32
2n 143×CCDB · ipcn-api-dl · CCDB · iapt
CCDB · ipcn-api-dl — Gagnidze, R., D. Mtskhvetadze, T. Gviniashvili & T. Avazneli. 1997. IOPB chromosome data 11. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 26/27: 18–20.
CCDB · ipcn-api-dl — Gadnidze, R. I., T. N. Gviniashvili, I. M. Danelia & M. V. Churadze. 1998. Chromosome numbers of the species of the Georgian flora. Bot. Žhurn. (Moscow & Leningrad) 83(10): 143–147.
CCDB · iapt — IAPT/IOPB Chromosome Data 19
n 1412×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +3
CCDB · iber-fl — Contribucin al conocimiento cariolgico de las Poaceae en Extremadura (Espaa). II. Devesa, J. A. & al.Bol. Soc. Brot. ser. 263: 153-205(1990).
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1987. SOCGI plant chromosome number reports -- IV [i.e., V]. J. Cytol. Genet. 22: 161–162.
CCDB · ipcn-api-dl — Devesa, J. A., T. RUIZ, A. Ortega, J. P. Carrasco, M. C. Viera, R. Torno & J. Pastor. 1990. Contribución al conocimiento cariológico de las Poaceae en Extremadura (Espana)---I. Bol. Soc. Brot., sér. 2 63: 29–66.
CCDB · ipcn-api-dl — Koul, K. K. & R. N. Gohil. 1991. Cytogenetic studies on some Kashmir grasses. VIII Tribe Agrostideae, Festuceae and Paniceae. Cytologia 56: 437–452.
CCDB · ipcn-api-dl — Moinuddin, M., A. A. Vahidy & S. I. Ali. 1994. Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan. Ann. Missouri Bot. Gard. 81(4): 784–791.
CCDB · book-ipcn75-78 — Mehra & Sharma 1977
CCDB · book-ipcn75-78 — Humphries 1978
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W.l Himalayan Pooideae. Cytologia 38: 237-258.
CCDB · CromoCat 2015 — Devesa, J. A., Ruiz, T., Ortega, A., Carrasco, J., Viera, M., Tormo, R. & Pastor, J. (1990a). Contribución al conocimiento cariológico de las Poaceae en Extremadura (España). II. Bol. Soc. Brot. 63: 153-205.
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1987). SOCGI plant chromosome number reports -- IV [i.e., V] J. Cytol. Genet. 22: 161-162
CCDB · CromoCat 2015 — Moinuddin, M., A. A. Vahidy & S. I. Ali (1994). Chromosome counts in Arundinoideae, Chloridoideae, and Poideae (Poaceae) from Pakistan Ann. Missouri Bot. Gard. 81(4): 784-791
CCDB · iapt — IAPT/IOPB Chromosome Data 29
n 02×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Korobkov, A. A., Kotseruba, V. V., Probatova, N. S. & Gnutikov, A. A.
Nina S. Probatova2* & Aleksandr A. Gnutikov1 (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:895-897
n 131×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Koul, K. K. (1990). Cytomixis in pollen mother cells of Alopecurus arundinaceus Poir. Cytologia 55:169-173
n 151×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Koul, K. K. (1990). Cytomixis in pollen mother cells of Alopecurus arundinaceus Poir. Cytologia 55:169-173
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type8 775 records
Wild obs. + sensor5 693
Museum / vouchered3 007
Cultivated / captive3
Other72
Origin
Native29
Introduced6
Range
Area of Occupancy AOO19 644 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy64% within 1 km
≤100 m 1 539≤1 km 1 749≤10 km 1 487>10 km 352
5 127 georeferenced · 566 without coordinates
Open the mapobservation + sensor5 693
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy36% within 1 km
≤100 m 172≤1 km 465≤10 km 626>10 km 519
1 782 georeferenced · 1 225 without coordinates
Open the institutions mapphysical evidence3 007
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 1
1 georeferenced · 2 without coordinates
Open the mapnot free-living3
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions83 of 147 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 424 |
| Moscow State Universitylocation not on record | 292 |
| LDlocation not on record | 233 |
| Irkutsk State Universitylocation not on record | 147 |
| Oulu, FI | 118 |
| Tartu, EE | 91 |
| Turku, FI | 75 |
| GMBAlocation not on record | 64 |
| Oskarshamn, SE | 62 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 61 |
| TROMlocation not on record | 60 |
| Denver, US | 59 |
| SLU Artdatabankenlocation not on record | 55 |
| UniKSlocation not on record | 54 |
| Uppsala, SE | 47 |
| Beijing, CN | 43 |
| Kuopio, FI | 40 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 39 |
| BClocation not on record | 39 |
| Kandalaksha State Nature Reservelocation not on record | 37 |
| València, ES | 32 |
| Badajoz, ES | 31 |
| CICYTEXlocation not on record | 29 |
| Entomological Society of Latvialocation not on record | 28 |
| Córdoba, ES | 26 |
| Logan, US | 25 |
| Olocation not on record | 24 |
| University of Stellenboschlocation not on record | 23 |
| Trondheim, NO | 22 |
| Jaén, ES | 20 |
| TUR-Alocation not on record | 20 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 20 |
| Granada, ES | 18 |
| Tallinn, EE | 18 |
| Philadelphia, US | 17 |
| Chadron, US | 16 |
| Salamanca, ES | 16 |
| Yangling, CN | 15 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 15 |
| St. Paul, US | 14 |
| Bozeman, US | 13 |
| Dresden, DE | 13 |
| Corvallis, US | 13 |
| Urumqi, CN | 12 |
| Porvoo, FI | 12 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 12 |
| Jyväskylä, FI | 11 |
| Wlocation not on record | 10 |
| Missoula, US | 9 |
| Wuzhou, CN | 8 |
| ISAlocation not on record | 8 |
| BRNUlocation not on record | 8 |
| Bronx, US | 8 |
| Claremont, US | 8 |
| Provo, US | 7 |
| Boise, US | 7 |
| WTUlocation not on record | 7 |
| Madrid, ES | 7 |
| Riverside, US | 6 |
| Xining, CN | 6 |
| Berlin, DE | 6 |
| Chicago, US | 6 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 6 |
| Barcelona, ES | 6 |
| Vancouver, CA | 6 |
| Moscow, US | 6 |
| Lincoln, US | 5 |
| Xiamen, CN | 5 |
| Jiangxi College of Educationlocation not on record | 5 |
| Pittsburg, US | 5 |
| Museo Achille Folettolocation not on record | 5 |
| Bergen, NO | 5 |
| QAUlocation not on record | 5 |
| MAlocation not on record | 5 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 4 |
| Fargo, US | 4 |
| CASlocation not on record | 4 |
| Pocatello, US | 4 |
| College of the Atlantic, Museumlocation not on record | 4 |
| Kew, GB | 4 |
| Institute of the biological problems of the North FEB RASlocation not on record | 4 |
| Saint Louis, US | 4 |
| Flagstaff, US | 3 |
| Stockholm, SE | 3 |
| nlocation not on record | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| KMNlocation not on record | 3 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 3 |
| Weber State Universitylocation not on record | 3 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 3 |
| Tromso University Museumlocation not on record | 3 |
| Henderson, US | 3 |
| Pullman, US | 3 |
| Nanjing, CN | 3 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 2 |
| Phoenix, US | 2 |
| Montréal, CA | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| South Kensington, GB | 2 |
| BFLlocation not on record | 2 |
| Chapel Hill, US | 2 |
| DOI/NPS, Greenbelt Parklocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| Brookings, US | 2 |
| EEZA-CSIClocation not on record | 2 |
| Rishon Le Zion, IL | 2 |
| Beijing, CN | 2 |
| Bloomington, US | 2 |
| Adam Mickiewicz University in Poznańlocation not on record | 2 |
| San Diego, US | 1 |
| Edinburgh, GB | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| McWane Science Centerlocation not on record | 1 |
| ASUlocation not on record | 1 |
| Pretoria, ZA | 1 |
| Madison, US | 1 |
| Portland, US | 1 |
| STUlocation not on record | 1 |
| Kunming, CN | 1 |
| Alicante, ES | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Lanzhou, CN | 1 |
| San Luis Obispo, US | 1 |
| Eastern Nevada Landscape Coalitionlocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| Davis, US | 1 |
| Toronto, CA | 1 |
| Victoria, CA | 1 |
| Ann Arbor, US | 1 |
| Spearfish, US | 1 |
| USFS/BHSClocation not on record | 1 |
| BioFokuslocation not on record | 1 |
| Uniwersytet Wrocławskilocation not on record | 1 |
| Rocky Mountain Biological Laboratorylocation not on record | 1 |
| Auckland, NZ | 1 |
| Minot State Universitylocation not on record | 1 |
| Guangzhou, CN | 1 |
| Universität Göttingenlocation not on record | 1 |
| Anchorage, US | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 1 |
| Caldwell, US | 1 |
| Bend, US | 1 |
| EL PASO, US | 1 |
| BDBClocation not on record | 1 |
| AUAlocation not on record | 1 |
147 institutions · 2 866 of 3 007 vouchered records shown · 129 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA27 detections
Where the DNA of Alopecurus arundinaceus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found27
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 27 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.1 °C 2.50–15.2
Seasonal swing summer↔winter21.1 °C
Max temp (day)13.2 °C 7.10–20.1
Min temp (night)9.00 °C -1.60–11.1
Precipitation75.6 mm/mo 33.4–112
Air humidity60.8 % 56.9–66.9
Moisture balance-23.3 mm/mo -72.6–28.4
Vapour deficit544 Pa 291–953
Wind speed3.80 m/s 2.20–4.60
Cloud cover59.4 % 38.2–64.4
CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.