Alopecurus aequalis
Sobol. · speciesAt a glance
Occurrence records59 841
Data sources12
Biological traits132
DNA specimens136
eDNA detections55
Sources12 archives
Databases and archives Alopecurus aequalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility59 841 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics136 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements6 literature sources132 traits
Occurrence & distributionGBIF59 841 records
Environmental DNA1 datasets · 11 countries55 detections
DNA & barcodingBOLD · NCBI136 specimens
Genome at a glanceCCDB · GoaT · NCBI3.5 Gbp
01Narrative
Alopecurus aequalis, le vulpin fauve, est une espèce de plantes monocotylédones de la famille des Poaceae, sous-famille des Pooideae, originaire des régions tempérées de l'hémisphère nord. Ce sont des plantes herbacées annuelles ou vivaces à courte durée de vie, aux tiges (chaumes) décombantes pouvant atteindre 335 cm de long, aux inflorescences en panicules spiciformes. Alopecurus aequalis est considérée comme une mauvaise herbes des cultures, notamment de céréales, en particulier de riz, dans de nombreux pays et plus spécialement en Asie. Une population a été signalée au Japon en 2005 dans des cultures de blé et d'orge d'hiver comme résistante à des herbicides du groupe K1 de la classification HRAC.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYAusTraitsWCVP
Size & morphology21
Leaf length150 mm
Leaf length max150 mm
Leaf length min20 mm
Leaf mass13.2 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 342 mm² · GIFT: 342 mm²
Leaf width2 mm
Leaf width max3 mm
Leaf width min1 mm
Plant height0.45 m
⚠ sources differ — GIFT: 0.45 m · LEDA: 0.14 m · USDA: 0.762 m · TRY: 0.4 m
Plant height generative0.175 m
Plant height max0.45 m
Plant height min0.1 m
Seed length2.27 mm
⚠ sources differ — TRY: 2.27 mm · GIFT: 1.6 mm
Seed length max1.6 mm
Seed length min1.6 mm
Seed mass0.179 mg
⚠ sources differ — TRY: 0.179 mg · LEDA: 0.174 mg · GIFT: 0.244 mg
Seed mass max0.36 mg
Seed mass min0.134 mg
Seed width0.8 mm
Seed width max0.8 mm
Seed width min0.8 mm
Life cycle & reproduction36
After harvest regrowth rateModerate
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flower colourgreen
Flower conspicuousNo
Flowering endAug
Flowering startMay
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDAModerate
Life formannual or biennial
Life spanperennial
⚠ sources differ — TRY: perennials · AusTraits: annual perennial · LEDA: perennials · GIFT: annual
Lifespan categoryShort
Lifespan years1 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerNo
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formhemicryptophyte
⚠ sources differ — LEDA: Hemicryptophyte · GIFT: therophyte
Reproduction asexualabsent
Resprout abilityNo
Seed number843
Seed spread rateModerate
Seedling vigorMedium
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation min0 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Fruit typecaryopsis
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: graminoid herb · TRY: Graminoid
Growth form USDABunch
Habitat GIFTcanals, forest, meadows: wet, rivers, swamps
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassYes
Mycorrhiza typenon-mycorrhizal
Root depth min6 in
Shape and orientationDecumbent
Small grainNo
Woodinessnon-woody
Physiology & chemistry24
Anaerobic toleranceHigh
C:N ratioLow
Caco3 toleranceNone
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min120 days
Leaf dry-matter content (LDMC)176 mg/g
Moisture useHigh
Nitrogen fixation levelNone
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Precipitation max45 in
Precipitation min18 in
Protein potentialLow
Salinity toleranceMedium
Seed longevity index0.5
Shade toleranceMedium
Soil pH max8 pH
Soil pH min5.5 pH
Specific leaf area (SLA)24.54 mm²/mg
Temperature min-38 °F
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityNo Known Source
Fodder productYes
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalLow
Palatable graze animalMedium
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 464 000 per lb
ToxicityNone
Veneer productNo
Other traits5
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousNo
Fruit seed persistenceNo
05DNA & barcoding136 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alopecurus aequalis has left across the world's sequence archives.
At a glance
DNA specimens136
Marker genes12
GenBank sequences10
eDNA detections55
Countries12
The DNA barcodea real sequence read deposited for this species
AACCTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGTGACCCTGACCAAAACA …
Alopecurus aequalis isolate M36_8size_34 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK1★rbcL2★rbcLa★trnL-F★ITS7★ITS1★ITS2atpF-atpHpsbK-psbIrpoBrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Alopecurus aequalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size3 530 580 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Alopecurus aequalis3.53 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–282n range14median14mode97records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1495×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · iapt +18
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Hindáková M. & Činčura F., 1968: Angaben über die Zahl und Morphologie der Chromosomen einiger Pflanzenarten aus dem Territorium der Ostslowakei I. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 14 [1967]: 181-227.
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · slov-fl — Murín A. & Záborský J., 1976: [Report], pp. 489. - In: Löve Á. (ed.), IOPB Chromosome number reports LIII, Taxon 25 /4.
CCDB · iapt — IAPT/IOPB Chromosome Data 6
CCDB · iapt
CCDB · brit-fl — Sieber, V.K., Murray, B.G. Bot. J. Linn. Soc. 79: 343-355 (1979)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4578
CCDB · fl-europaea — Majovsky et al.,
CCDB · poland — Pogan E., Jankun A., Ma?ecka J., Wcis?o H. et al. 1986. Further studies in chromosome numbers of Polish Angiosperms. Part XIX. Acta Biol. Cracov. Ser. Bot. 28, 65-85.
CCDB · mediterranean
CCDB · book-ipcn65 — Sokolovskaya 1965
CCDB · ipcn-api-dl — Dogan, M. 1983. Chromosome counts of Turkish grasses. Willdenowia 13: 345–347.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun, J. Maslecka & H. Wcisslo. 1986. Further studies in chromosome numbers of Polish angiosperms. Part XIX. Acta Biol. Cracov., Ser. Bot. 28: 65–85.
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Guzik, M. B. 1984. Khromosomnye chisla nekotorykh dikorastushchikh zlakov Predural'ja. Ekologija Opylenija Rastenij. Mezhvuzovskij Sbornik Nauchnykh Trudov. Perm. 82–86.
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
CCDB · ipcn-api-dl — Duckert-Henriod, M. M. 1991. Mediterranean chromosome number reports 1 (7--25). Fl. Medit. 1: 229–236.
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1981. Chromosome numbers of some aquatic and bank plant species of the flora in the Amur River basin in connection with the peculiarities of its formation. Bot. Zhurn. 66 (11): 1584–1594.
CCDB · ipcn-api-dl — Sieber, V. K. & B. G. Murray. 1979. The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343–355.
CCDB · ipcn-api-dl — Strid, A. & R. Franzen. 1981. In Chromosome number reports LXXIII. Taxon 30: 829–842.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1981. In Chromosome number reports LXX. Taxon 30: 72.
CCDB · ipcn-api-dl — Wentworth, J. E. 2004. An assessment of the origin of Alopecurus geniculatus L. based on 2C DNA amounts, NOR sites, RAPDs and cpDNA analysis. Watsonia 25: 137–155.
CCDB · ipcn-api-dl — Probatova. 2004. Chromosome numbers of some representatives of the flora of the Primorsky Territory. Bot. Žhurn. (Moscow & Leningrad) 89(7): 1209–1217.
CCDB · ipcn-api-dl — Seledets. 2005. Ecological area of species: karyological aspects. Pages 95--97 in Karyology, Karyosystematics and Molecular Phylogeny. St. Petersburg, Russia.
CCDB · book-ipcn66 — Sokolovskaya 1966
CCDB · book-ipcn67-71 — HINDAKOVA, M., & F. CINCURA. 1967. Angaben Uber die Zahl und Morphologie der Chromosomen einiger Pf lanzenarten aus dem Territorium der Ostslowakei I. Acta Fae. Rerum Nat. Univ. Comenianae. Bot. 14: 181-227.
CCDB · book-ipcn67-71 — MULLIGAN, G.A., & A.E. PORSILD. 1969. Chromosome numbers of some plants from the unglaciated central Yukon plateau, Canada. Canad. J. Bot. 47: 655-662.
CCDB · book-ipcn67-71 — KNABEN, G., & T. ENGELSKJON. 1967. Chromosome numbers of Scandinavian arctic-alpine plant species. II. Act. Boreal. A. Sci. No. 21: 1-57.
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W.l Himalayan Pooideae. Cytologia 38: 237-258.
CCDB · book-indian_vol2 — Katterman, G. 1930 ; Johnsson, H. 1941 ; Ono, H. & Tateoka, T. 1953; Hubbard, C.E. 1954 ; Tateoka, T. 1954 ; LOve, A. & LISve. D. 1956b; J!Srgensen, C.A. et al. 1958 : Bowden, W.M. 1960b Chen C.C. & Hsu, C.C. 1962; Sokolo~skaya: A.P. (Fedorov) ; Kozuharov, S. & Kuzmanov, B. 1964b ; Anderson, D.E. 1965 ; Hindakova, M. & Cincura, F. 1967 ; Knaben, G. & Engelskjon, T. 1967 ; Mehra, P.N. & Sunder, S. 1969; Mulligan, G.A. & Porslld, A.E. 19..69 ; Mehra, P.N. & Remanandan, P. 1973a; Mehra, P.R & Sharma, M.L. 1977
CCDB · book-indian_vol2 — Kattermann, G. 1930 ; Tischler, G. 1934 ; Rohweder, H. 1937 ; Delay, J. 1969e
CCDB · eflora
CCDB · book-fedorov — Katterman 1930
CCDB · book-fedorov — Johnsson 1941
CCDB · book-fedorov — Ono H., Tateoka 1953
CCDB · book-fedorov — Hubbard 1954
CCDB · book-fedorov — Tatcoka 1954
CCDB · book-fedorov — LOve A., LOve D. 195tib
+34 more references
2n 282×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1990). Cytological studies on some Kashmir grasses VI. Cytomorphological polymorphism in Alopecurus aequalis Sobol. Cytologia 55:217-223
CCDB · CromoCat 2015 — Sorokin, S.N. (1990). Chromosome numbers in members of the Poaceae family from the north-west of the European part of the USSR. Bot. Zurn. 75:1185
n 715×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · book-ipcn65 — Anderson 1965
CCDB · ipcn-api-dl — Dalgaard, V. 1989. Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199–213.
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · book-ipcn67-71 — HSU, c-c. 1971. Preliminary chromosome studies on the vascular plants of Taiwan (IV). Counts and some systematic notes on some monocotyledons. Taiwania 16: 123-136.
CCDB · book-ipcn67-71 — DELAY, J. 1969. Haute Provence. Inf. Ann. Caryosyst. et Cytogenet. 3: 27-28.
CCDB · book-ipcn75-78 — Reeder 1977
CCDB · book-ipcn75-78 — Mehra & Sharma 1977
CCDB · book-ipcn73-74 — MEHRA, P.N., & P. REMANANDAN. 1973. Cytological investigations on W.l Himalayan Pooideae. Cytologia 38: 237-258.
CCDB · book-ipcn73-74 — DAVIDSE, G., & R.W. POHL. 1974. Chromosome numbers, meiotic behavior, and notes on tropical American grasses (Gramineae). Canad. J. Bot. 52: 317-328.
CCDB · Cave1962 — Chen & Hsu 1962
CCDB · CromoCat 2015 — Dalgaard, V. (1989). Additional chromosome numbers in vascular plants from the Disko Bugt area (west Greenland). Willdenowia 19: 199-213.
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Koul, K. K. & Gohil, R. N. (1990). Cytological studies on some Kashmir grasses VI. Cytomorphological polymorphism in Alopecurus aequalis Sobol. Cytologia 55:217-223
n 144×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Gohil, R. N. & K. K. Koul. 1986. SOCGI plant chromosome number reports -- IV. J. Cytol. Genet. 21: 155.
CCDB · CromoCat 2015 — Gohil, R. N. & Koul, K. K. (1986). SOCGI plant chromosome number reports -- IV. Journal of Cytology and Genetics 21: 155
CCDB · CromoCat 2015 — Sieber, V. K. & B. G. Murray. (1979). The cytology of the genus Alopecurus (Gramineae). Bot. J. Linn. Soc. 79: 343-355.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Korobkov, A. A., Kotseruba, V. V., Probatova, N. S. & Gnutikov, A. A.
Nina S. Probatova2* & Aleksandr A. Gnutikov1 (2012). IAPT/IOPB Chromosome Data 13 Taxon 61:895-897
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
08Occurrence & distribution
Record type59 841 records
Wild obs. + sensor47 696
Museum / vouchered11 824
Cultivated / captive14
Other307
Origin
Native1 266
Introduced98
Range
Area of Occupancy AOO137 820 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy46% within 1 km
≤100 m 6 369≤1 km 11 598≤10 km 20 001>10 km 1 006
38 974 georeferenced · 8 722 without coordinates
Open the mapobservation + sensor47 696
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy42% within 1 km
≤100 m 598≤1 km 1 893≤10 km 2 420>10 km 1 059
5 970 georeferenced · 5 854 without coordinates
Open the institutions mapphysical evidence11 824
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 1>10 km 10
11 georeferenced · 3 without coordinates
Open the mapnot free-living14
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions197 of 379 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Helsinki, FI | 695 |
| Uniwersytet Wrocławskilocation not on record | 536 |
| Moscow State Universitylocation not on record | 525 |
| Olocation not on record | 409 |
| BFLlocation not on record | 309 |
| LDlocation not on record | 296 |
| BRNUlocation not on record | 262 |
| Bronx, US | 213 |
| Beijing, CN | 212 |
| Kuopio, FI | 202 |
| Uppsala, SE | 164 |
| Chicago, US | 164 |
| Trondheim, NO | 162 |
| Oulu, FI | 155 |
| St. Paul, US | 138 |
| Victoria, CA | 136 |
| WTUlocation not on record | 123 |
| MeiseBGlocation not on record | 122 |
| Pullman, US | 119 |
| Madison, US | 116 |
| Chengdu, CN | 109 |
| Tartu, EE | 107 |
| TROMlocation not on record | 103 |
| Odawara, JP | 102 |
| Logan, US | 100 |
| Corvallis, US | 99 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 98 |
| Vancouver, CA | 95 |
| SLU Artdatabankenlocation not on record | 94 |
| Missoula, US | 94 |
| NSMKlocation not on record | 93 |
| Moscow, US | 92 |
| Salzburg, AT | 92 |
| Garðabær, IS | 90 |
| Québec, CA | 87 |
| Yangling, CN | 85 |
| Chiba, JP | 83 |
| Turku, FI | 82 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 81 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 78 |
| Provincia di Livornolocation not on record | 74 |
| Claremont, US | 73 |
| CJBGlocation not on record | 73 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 72 |
| Wuzhou, CN | 69 |
| Guangzhou, CN | 69 |
| Oskarshamn, SE | 69 |
| Denver, US | 69 |
| Flagstaff, US | 68 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 67 |
| Ann Arbor, US | 66 |
| Irkutsk State Universitylocation not on record | 63 |
| Oregon State Universitylocation not on record | 62 |
| University of Alberta Museumslocation not on record | 62 |
| Görlitz, DE | 60 |
| Davis, US | 58 |
| BIO-UNIPIlocation not on record | 58 |
| Université Lavallocation not on record | 56 |
| Albuquerque, US | 55 |
| International Salmonella Centre (W.H.O.)location not on record | 54 |
| John May Museum of Natural Historylocation not on record | 50 |
| Bergen, NO | 46 |
| University of Stellenboschlocation not on record | 45 |
| Jyväskylä, FI | 44 |
| Awka, NG | 44 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 44 |
| Bloomington, US | 44 |
| Wlocation not on record | 43 |
| Bozeman, US | 43 |
| Bern, CH | 40 |
| DBF-NHMDlocation not on record | 39 |
| Saint Louis, US | 39 |
| Caldwell, US | 37 |
| Nanjing, CN | 35 |
| Burlington, US | 35 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 35 |
| Bando, JP | 34 |
| Chongqing Museumlocation not on record | 33 |
| Provo, US | 33 |
| Adam Mickiewicz University in Poznańlocation not on record | 33 |
| Riverside, US | 33 |
| Kunming, CN | 32 |
| Chengdu, CN | 32 |
| University of New Hampshirelocation not on record | 31 |
| KR | 31 |
| 30 | |
| CASlocation not on record | 30 |
| Museo Entomologico de Leonlocation not on record | 29 |
| KOMlocation not on record | 29 |
| MAlocation not on record | 29 |
| BClocation not on record | 27 |
| Pocatello, US | 27 |
| GJOlocation not on record | 27 |
| Chadron, US | 27 |
| Sanda, JP | 26 |
| Berlin, DE | 25 |
| Kawasaki Shi Tama Ku, JP | 24 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 24 |
| Zürich, CH | 23 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 22 |
| Lincoln, US | 21 |
| Uniwersytet Jagiellońskilocation not on record | 21 |
| Anchorage, US | 21 |
| Boise, US | 20 |
| South Kensington, GB | 20 |
| Zürich, CH | 20 |
| Philadelphia, US | 20 |
| Institute of the biological problems of the North FEB RASlocation not on record | 20 |
| Montréal, CA | 19 |
| Barcelona, ES | 18 |
| València, ES | 17 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 16 |
| DOI/NPS, Greenbelt Parklocation not on record | 16 |
| No collectionlocation not on record | 16 |
| QAUlocation not on record | 16 |
| Green Bay, US | 16 |
| WINlocation not on record | 15 |
| Seoul, KR | 15 |
| San Diego, US | 15 |
| Saint John, CA | 15 |
| Taipei, TW | 15 |
| Uniwersytet Warszawskilocation not on record | 15 |
| Nijmegen, NL | 14 |
| Nagatoro-machi, Chichibu-gun, JP | 14 |
| Dresden, DE | 14 |
| Kew, GB | 14 |
| SZUlocation not on record | 14 |
| Entomological Society of Latvialocation not on record | 14 |
| Phoenix, US | 14 |
| National Institute of Biological Resourceslocation not on record | 13 |
| Xining, CN | 13 |
| Hangzhou, CN | 13 |
| Toronto, CA | 13 |
| Guilin, CN | 13 |
| PRClocation not on record | 12 |
| GZUlocation not on record | 12 |
| Spearfish, US | 12 |
| Xiamen, CN | 12 |
| Tampa, US | 12 |
| Wuhan, CN | 12 |
| Kochi, JP | 12 |
| LfUlocation not on record | 11 |
| Kyoto Universitylocation not on record | 11 |
| nlocation not on record | 11 |
| Tallinn, EE | 11 |
| DMZ botanic gardenlocation not on record | 11 |
| EL PASO, US | 11 |
| ASUlocation not on record | 11 |
| Philadelphia, US | 10 |
| Guangzhou, CN | 10 |
| Forssa, FI | 10 |
| Vitoria, ES | 10 |
| Kandalaksha State Nature Reservelocation not on record | 10 |
| Arcata, US | 10 |
| Canadian Department of Agriculturelocation not on record | 10 |
| Yukon Universitylocation not on record | 10 |
| Ishikawa Museum of Natural Historylocation not on record | 10 |
| San Isidro, AR | 10 |
| IWEP FEB RASlocation not on record | 9 |
| Urumqi, CN | 9 |
| McWane Science Centerlocation not on record | 9 |
| Auckland, NZ | 9 |
| Durango, US | 9 |
| VALElocation not on record | 8 |
| KMNlocation not on record | 8 |
| TUR-Alocation not on record | 8 |
| Salamanca, ES | 8 |
| University of Wisconsinlocation not on record | 8 |
| ZRC-SAZUlocation not on record | 8 |
| Elocation not on record | 8 |
| Beijing, CN | 8 |
| Ciudad Autónoma de Buenos Aires, AR | 8 |
| SIHUlocation not on record | 8 |
| nbflocation not on record | 8 |
| New Haven, US | 8 |
| BSBIlocation not on record | 8 |
| PrivatHerblocation not on record | 7 |
| US | 7 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 7 |
| Cheney, US | 7 |
| Paris, FR | 7 |
| Rovaniemi, FI | 7 |
| Henderson, US | 7 |
| Frauenfeld, CH | 7 |
| Taipei, TW | 7 |
| Bend, US | 7 |
| Orem, US | 7 |
| Zhengzhou, CN | 7 |
| San Luis Obispo, US | 6 |
| Mlocation not on record | 6 |
| GMBAlocation not on record | 6 |
| Frankfurt am Main | 6 |
| Angwin, US | 6 |
| Russian Academy of Sciences, Komarov Botanical Institutelocation not on record | 6 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 6 |
| UniKSlocation not on record | 6 |
| Staten Island, US | 6 |
| Portland, US | 6 |
| Tilburg, NL | 6 |
| Whitehorse, CA | 6 |
| Durham, US | 6 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 5 |
| IDElocation not on record | 5 |
| Weber State Universitylocation not on record | 5 |
| Hobart, AU | 5 |
| Edinburgh, GB | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Tacoma, US | 5 |
| San Jose, US | 5 |
| Chicago, US | 5 |
| Rocky Mountain Biological Laboratorylocation not on record | 5 |
| Changsha, CN | 5 |
| INFlocation not on record | 5 |
| Lausanne, CH | 5 |
| San Angelo, US | 5 |
| Museum of the Rockieslocation not on record | 5 |
| Tokushima, JP | 5 |
| Natural History Museum Rotterdamlocation not on record | 5 |
| Porvoo, FI | 5 |
| Fredericton Stock Culture Collectionlocation not on record | 5 |
| DNSMlocation not on record | 4 |
| College Park, US | 4 |
| Canberra, AU | 4 |
| Tromso University Museumlocation not on record | 4 |
| Nagano City, JP | 4 |
| Adelaide, AU | 4 |
| University of Winnipeglocation not on record | 4 |
| Stockholm, SE | 4 |
| Central China Normal Universitylocation not on record | 4 |
| Dekalb, US | 4 |
| Xian, CN | 4 |
| Korea National Arboretumlocation not on record | 4 |
| Istituto Agrario Castelnuovolocation not on record | 4 |
| Jena Microbial Resource Collectionlocation not on record | 4 |
| Royal Botanic Garden Edinburghlocation not on record | 4 |
| Ashland, US | 4 |
| USFSlocation not on record | 4 |
| Fukushima Universitylocation not on record | 4 |
| Porrentruy, CH | 4 |
| University of Lethbridgelocation not on record | 4 |
| Northeastern Forestry Universitylocation not on record | 4 |
| Castelar, AR | 4 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 3 |
| Tsukuba, JP | 3 |
| Canadian Museum of Nature, National Herbarium of Canadalocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Taipei, TW | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| J.F.Oberlin Universitylocation not on record | 3 |
| Anhui Normal Universitylocation not on record | 3 |
| Yunnan Universitylocation not on record | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| Irvine, US | 3 |
| Lanzhou, CN | 3 |
| Shanghai, CN | 3 |
| Fulda, DE | 3 |
| Ypsilanti, US | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| GB | 3 |
| US | 3 |
| Jiangxi College of Educationlocation not on record | 3 |
| Sendai, JP | 3 |
| Parkville, AU | 3 |
| Zhejiang Universitylocation not on record | 3 |
| Grand Junction, US | 3 |
| DULlocation not on record | 2 |
| University of Manitoba Herbariumlocation not on record | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Nagasaki University - Fisherieslocation not on record | 2 |
| Capital Normal Universitylocation not on record | 2 |
| Bangkok, TH | 2 |
| Universität Göttingenlocation not on record | 2 |
| Fort Worth, US | 2 |
| Winterthur, CH | 2 |
| Wellington, NZ | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| DOI/NPS, San Juan Island National Historical Parklocation not on record | 2 |
| Shanxi Universitylocation not on record | 2 |
| Santa Barbara, US | 2 |
| GINRlocation not on record | 2 |
| Chapel Hill, US | 2 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| Inner Mongolia Universitylocation not on record | 2 |
| Grassland Research Institute, Chinese Academy of Agricultural Scienceslocation not on record | 2 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 2 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 2 |
| Los Angeles, US | 2 |
| Shanghai, CN | 2 |
| Sion, CH | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Eastern Nevada Landscape Coalitionlocation not on record | 2 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 2 |
| Forest Herbarium Ibadan (FHI)location not on record | 2 |
| Fullerton, US | 2 |
| Brisbane, AU | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Columbia, US | 1 |
| Royal Alberta Museumlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| BAlocation not on record | 1 |
| South China Normal Universitylocation not on record | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| RABATlocation not on record | 1 |
| Dhaka, BD | 1 |
| Museum Of Natural And Environmental History, Shizuokalocation not on record | 1 |
| Tuscaloosa, US | 1 |
| H-Schuhwlocation not on record | 1 |
| Jackson, US | 1 |
| Coimbra, PT | 1 |
| Severin-McDaniel Insect Collectionlocation not on record | 1 |
| Davenport, US | 1 |
| SJNAlocation not on record | 1 |
| Minia, EG | 1 |
| Corrientes, AR | 1 |
| H-Hohlalocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Agriculture and Agri-Food Canada, Vascular Plant Herbariumlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Little Rock, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Namur, BE | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| FLADlocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Durango, MX | 1 |
| CJBNlocation not on record | 1 |
| Christchurch, NZ | 1 |
| Pittsburg, US | 1 |
| Fujian Institute of Subtropical Botanylocation not on record | 1 |
| Armidale, AU | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Sagamihara, JP | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Truckee, US | 1 |
| Kushiro City Museumlocation not on record | 1 |
| Austin, US | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| University of Birminghamlocation not on record | 1 |
| KURAlocation not on record | 1 |
| Hanshan Normal Universitylocation not on record | 1 |
| Whitewater, US | 1 |
| Boumlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Long Beach, US | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Kingston, US | 1 |
| STNFlocation not on record | 1 |
| Gijón, ES | 1 |
| NoColllocation not on record | 1 |
| University of Alberta, Microfungus Collection and Herbariumlocation not on record | 1 |
| Chicago, US | 1 |
| Brussel, BE | 1 |
| Bandelier National Monumentlocation not on record | 1 |
| GNWPlocation not on record | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Knoxville, US | 1 |
| Kagoshima, JP | 1 |
| KNAMlocation not on record | 1 |
| BGBMlocation not on record | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Bourges, FR | 1 |
| Karlsruhe, DE | 1 |
| Mount Annan, AU | 1 |
| Arequipa, PE | 1 |
| H-AkrKGlocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Mexico City, MX | 1 |
| La Trobe Universitylocation not on record | 1 |
| Aarhus, DK | 1 |
| Smithfield, AU | 1 |
| Hudson, US | 1 |
| BG-NMNHSlocation not on record | 1 |
379 institutions · 11 098 of 11 824 vouchered records shown · 677 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA55 detections
Where the DNA of Alopecurus aequalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found55
Studies independent surveys1
Countries11
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 55 detections have coordinates
Open the map11 countries0
Rice paddy bundsgrowing in pond with water hemlock, carex sp…Montane meadow; Downingia concolor ssp. brev…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.9 °C 8.00–18.9
Seasonal swing summer↔winter27.0 °C
Max temp (day)17.6 °C 11.6–24.5
Min temp (night)9.10 °C 2.00–14.5
Precipitation80.3 mm/mo 50.4–112
Air humidity58.3 % 54.4–64.9
Moisture balance-31.4 mm/mo -82.5–29.4
Vapour deficit690 Pa 421–984
Wind speed3.20 m/s 2.30–4.60
Cloud cover41.1 % 35.4–58.6
CHELSA 1981–2010, ~9 km grid, at location & month of 36 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.