Alona guttata

Sars, 1862 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Branchiopoda/Diplostraca/Chydoridae/Alona

At a glance

Occurrence records2 688

Data sources5

Biological traits2

DNA specimens7

eDNA detections5

Sources5 archives

Databases and archives Alona guttata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 688 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF2 688 records

Environmental DNA1 datasets · 3 countries5 detections

DNA & barcodingBOLD7 specimens

01Narrative

Alona guttata is een watervlooiensoort uit de familie van de Chydoridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1862 door Sars.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat freshwateryes

Habitat zonepelagic

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alona guttata has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections5

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

364Cvariable

AACACTCTATTTTTTGTTTGGTATTTGATCAGGGATGGTTGGAACAGCTTTAAGTTTATTAATTCGAGTTGAACTTGGTCAAGCTGGGAG …

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type2 688 records

Wild obs. + sensor2 299

Museum / vouchered318

Cultivated / captive2

Other69

Origin

Native116

Range

Area of Occupancy AOO4 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 1 311≤1 km 63≤10 km 15>10 km 1

1 390 georeferenced · 909 without coordinates

Open the mapobservation + sensor2 299

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 139≤1 km 65≤10 km 7>10 km 2

213 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence318

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 20 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	109
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	57
Institute of Ecology of the Volga river basin of Russian Academy of Sciences \| IEVB RASlocation not on record	54
Brussels, BE	12
RBINS-Scientific Heritagelocation not on record	5
Museum für Naturkunde Berlin (Zoological Collections)location not on record	4
Research Collection of Anders Hobaeklocation not on record	3
Princess Maha Chakri Sirindhorn Natural History Museum (PSU Museum, Prince of Songkla University, Thailand)location not on record	3
University of Oslo (UiO)location not on record	2
ELlocation not on record	2
Frankfurt am Main	2
Sydney, AU	2
University of Alberta Museums (UAM)location not on record	2
Stockholm, SE	2
Washington, US	1
South Kensington, GB	1
New Haven, US	1
Victoria, CA	1
SBJlocation not on record	1
Helsinki, FI	1

20 institutions · 265 of 318 vouchered records shown · 52 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA5 detections

Where the DNA of Alona guttata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map3 countries0

Pond

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 13.6–21.1

Seasonal swing summer↔winter29.3 °C

Max temp (day)20.7 °C 16.2–24.8

Min temp (night)11.5 °C 11.5–17.9

Precipitation93.3 mm/mo 93.3–184

Air humidity58.8 % 58.8–63.2

Moisture balance-37.6 mm/mo -37.6–62.4

Vapour deficit730 Pa 625–962

Wind speed2.90 m/s 2.90–6.30

Cloud cover41.1 % 41.0–46.3

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alona guttata

At a glance

Sources5 archives

Habitat & environment2

At a glance

Record type2 688 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 20 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 688 records