Alona costata

Sars, 1862 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Branchiopoda/Diplostraca/Chydoridae/Alona

At a glance

Occurrence records923

Data sources7

Biological traits0

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Alona costata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility910 records↗

OBISOcean Biodiversity Information System13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF · OBIS923 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Alona costata is een watervlooiensoort uit de familie van de Chydoridae. De wetenschappelijke naam van de soort werd in 1862 voor het eerst geldig gepubliceerd door Georg Ossian Sars.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alona costata has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

24Tmostly conserved

37Amostly conserved

58Cmostly conserved

59Tmostly conserved

76Tmostly conserved

115Tmostly conserved

212Tmostly conserved

232Cmostly conserved

282Cmostly conserved

337Cmostly conserved

367Tmostly conserved

376Amostly conserved

379Cvariable

418Tmostly conserved

487Gmostly conserved

511Gmostly conserved

523Cmostly conserved

592Gmostly conserved

616Tvariable

625Avariable

652Cmostly conserved

TACACTTTACTTTTTATTCGGAATTTGAGCAGGAATAGTTGGGACAGCTTTAAGTCTCTTAATTCGAATTGAGCTTGGTCAGGCAGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.80%

Haplotypes7

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Simocephalus exspinosussame order16.6%Alona glabrasame genus17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type923 records

Wild obs. + sensor742

Museum / vouchered179

Other2

Origin

Native27

Range

Area of Occupancy AOO1 636 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 576≤1 km 15≤10 km 9

600 georeferenced · 142 without coordinates

Open the mapobservation + sensor742

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy92% within 1 km

≤100 m 75≤1 km 24≤10 km 9

108 georeferenced · 71 without coordinates

Open the institutions mapphysical evidence179

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	32
NTNU-VMlocation not on record	32
Institute of Ecology of the Volga river basin of Russian Academy of Sciences \| IEVB RASlocation not on record	27
Tapachula, MX	20
Washington, US	13
Museum für Naturkunde Berlin (Zoological Collections)location not on record	8
Brussels, BE	6
Cambridge, US	1
FURGlocation not on record	1
Victoria, CA	1
Helsinki, FI	1
University of Oslo (UiO)location not on record	1
Toronto, CA	1
Frankfurt am Main	1
Copenhagen, DK	1
Sydney, AU	1

16 institutions · 147 of 179 vouchered records shown · 19 without an institution code

09Environmental DNA10 detections

Where the DNA of Alona costata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

Lake

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 12.3–16.3

Seasonal swing summer↔winter29.3 °C

Max temp (day)20.7 °C 17.0–21.5

Min temp (night)11.6 °C 8.30–11.9

Precipitation88.9 mm/mo 80.4–93.3

Air humidity58.6 % 58.3–59.4

Moisture balance-37.6 mm/mo -43.9–-27.4

Vapour deficit730 Pa 629–767

Wind speed2.90 m/s 2.60–3.20

Cloud cover41.3 % 41.1–46.8

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)