Alona affinis

(Leydig, 1860) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Branchiopoda/Diplostraca/Chydoridae/Alona

At a glance

Occurrence records5 119

Data sources7

Biological traits3

DNA specimens16

eDNA detections17

Sources7 archives

Databases and archives Alona affinis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 101 records↗

OBISOcean Biodiversity Information System18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS5 119 records

Environmental DNA1 datasets · 5 countries17 detections

DNA & barcodingBOLD16 specimens

01Narrative

Biapertura affinis is een watervlooiensoort uit de familie van de Chydoridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1860 door Leydig.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment3

Habitat brackishyes

Habitat freshwateryes

Habitat zonebenthic

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alona affinis has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections17

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 85% of positions are identical in every specimen.

Diversity (π)2.0%

Haplotypes2

BINs2

Most divergent pair1.8%

Where individuals differ — all 99 variable positions, in barcode order

22Cmostly conserved

31Amostly conserved

34Amostly conserved

46Tmostly conserved

50Tmostly conserved

52Amostly conserved

55Amostly conserved

56Tmostly conserved

58Amostly conserved

67Amostly conserved

74Cmostly conserved

76Tmostly conserved

83Gmostly conserved

85Amostly conserved

103Cmostly conserved

109Gmostly conserved

115Tmostly conserved

118Cmostly conserved

122Gmostly conserved

124Amostly conserved

133Amostly conserved

166Amostly conserved

169Tmostly conserved

175Amostly conserved

181Tmostly conserved

184Amostly conserved

190Amostly conserved

196Gmostly conserved

197Tmostly conserved

199Amostly conserved

212Cmostly conserved

220Cmostly conserved

238Tmostly conserved

241Tmostly conserved

250Cmostly conserved

256Amostly conserved

259Tmostly conserved

263Tmostly conserved

271Cmostly conserved

274Amostly conserved

283Tmostly conserved

284Tmostly conserved

286Amostly conserved

287Cmostly conserved

289Cmostly conserved

293Amostly conserved

301Amostly conserved

316Gmostly conserved

331Amostly conserved

334Tmostly conserved

349Gmostly conserved

352Gmostly conserved

355Amostly conserved

358Gmostly conserved

373Amostly conserved

376Amostly conserved

382Tmostly conserved

391Tmostly conserved

403Amostly conserved

412Tmostly conserved

428Tmostly conserved

439Amostly conserved

448Cmostly conserved

451Cmostly conserved

469Amostly conserved

474Amostly conserved

478Amostly conserved

481Gmostly conserved

484Tmostly conserved

487Gmostly conserved

502Amostly conserved

508Amostly conserved

514Tmostly conserved

517Tmostly conserved

520Tmostly conserved

523Cmostly conserved

526Amostly conserved

539Tmostly conserved

541Amostly conserved

544Gmostly conserved

548Cmostly conserved

550Tmostly conserved

556Cmostly conserved

562Tmostly conserved

577Gmostly conserved

578Cmostly conserved

580Tmostly conserved

586Tmostly conserved

589Cmostly conserved

595Tmostly conserved

601Tmostly conserved

622Tmostly conserved

625Amostly conserved

627Gmostly conserved

628Gmostly conserved

631Gmostly conserved

637Cmostly conserved

646Cmostly conserved

655Tmostly conserved

TACACTTTACTTTCTTTTTGGCATTTGGGCAGGAATAGTAGGAACTGCTTTAAGATTATTAATTCGAATTGAACTTGGTCAAGGAGGGAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Graptoleberis testudinariasame family16.6%Daphnia sinensissame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 119 records

Wild obs. + sensor4 265

Museum / vouchered792

Cultivated / captive25

Other37

Origin

Native7

Range

Area of Occupancy AOO7 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 2 645≤1 km 68≤10 km 25>10 km 4

2 742 georeferenced · 1 523 without coordinates

Open the mapobservation + sensor4 265

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy98% within 1 km

≤100 m 545≤1 km 25≤10 km 11>10 km 1

582 georeferenced · 210 without coordinates

Open the institutions mapphysical evidence792

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the mapnot free-living25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	561
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	40
Victoria, CA	12
Brussels, BE	11
Tapachula, MX	9
Museum für Naturkunde Berlin (Zoological Collections)location not on record	8
Stockholm, SE	3
RBINS-Scientific Heritagelocation not on record	3
Sydney, AU	3
Princess Maha Chakri Sirindhorn Natural History Museum (PSU Museum, Prince of Songkla University, Thailand)location not on record	2
Cambridge, US	2
Helsinki, FI	2
El Colegio de la Frontera Sur, Unidad Chetumallocation not on record	1
FURGlocation not on record	1
BioFokuslocation not on record	1
University of Oslo (UiO)location not on record	1

16 institutions · 660 of 792 vouchered records shown · 114 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA17 detections

Where the DNA of Alona affinis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map5 countries0

Nearshore/Benthic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.00 °C 8.00–17.4

Seasonal swing summer↔winter26.4 °C

Max temp (day)12.9 °C 12.5–21.4

Min temp (night)5.10 °C 5.10–14.3

Precipitation80.0 mm/mo 80.0–97.7

Air humidity61.7 % 59.2–65.2

Moisture balance20.8 mm/mo -29.5–29.0

Vapour deficit410 Pa 410–819

Wind speed4.60 m/s 2.40–4.60

Cloud cover55.3 % 46.1–59.9

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alona affinis

At a glance

Sources7 archives

Habitat & environment3

At a glance

Record type5 119 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions7 of 16 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 119 records