Aloeides pallida

(Riley, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Aloeides

At a glance

Occurrence records37

Data sources8

Biological traits0

DNA specimens25

eDNA detections49

Sources8 archives

Databases and archives Aloeides pallida's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility37 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics25 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF37 records

Environmental DNA1 datasets · 1 countries49 detections

DNA & barcodingBOLD25 specimens

01Narrative

Aloeides pallida, the giant copper, is a butterfly of the family Lycaenidae. It is found in South Africa. The wingspan is 30–39 mm for males and 34–45 mm females. Adults are on wing from October to early January or as early as August for the nominate subspecies. There is one generation per year. The larvae of subspecies A. p. pallida and A. p. jonathani feed on Aspalathus species. The larvae of subspecies A. p. grandis are fed by trophallaxis by Lepisiota capensis ants. They also feed on the eggs of these ants.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding25 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloeides pallida has left across the world's sequence archives.

At a glance

DNA specimens25

BINs3

Marker genes1

eDNA detections49

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus25 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

38Gmostly conserved

58Tmostly conserved

59Cmostly conserved

76Gvariable

82Tmostly conserved

127Cmostly conserved

139Tmostly conserved

206Tmostly conserved

212Cmostly conserved

271Tmostly conserved

298Amostly conserved

355Tmostly conserved

362Gmostly conserved

389Gvariable

400Tmostly conserved

406Tmostly conserved

412Amostly conserved

427Tmostly conserved

448Cmostly conserved

470Avariable

520Tmostly conserved

530Tmostly conserved

542Cmostly conserved

574Cmostly conserved

589Tmostly conserved

646Cmostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCACTAAGAATTCTAATTCGTATAGAATTGGGAACTCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes9

BINs3

Most divergent pair4.1%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aloeides thyrasame genus1.5%Aloeides dentatissame genus1.5%Aloeides rileyisame genus1.5%Aloeides penningtonisame genus1.7%Aloeides titeisame genus1.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type37 records

Wild obs. + sensor17

Museum / vouchered20

Range

Area of Occupancy AOO104 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 11≤1 km 1

12 georeferenced · 5 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤10 km 5

6 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ZSMlocation not on record	10
Cambridge, US	4
New Haven, US	3
Teylers Museumlocation not on record	2
MZLUlocation not on record	1

5 institutions · 20 of 20 vouchered records shown

09Environmental DNA49 detections

Where the DNA of Aloeides pallida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 13.6–18.9

Seasonal swing summer↔winter10.4 °C

Max temp (day)22.5 °C 18.0–25.0

Min temp (night)11.9 °C 6.20–15.5

Precipitation44.8 mm/mo 18.0–109

Air humidity58.7 % 48.9–62.9

Moisture balance-95.6 mm/mo

Vapour deficit808 Pa 714–1,026

Wind speed3.80 m/s

Cloud cover15.3 % 10.8–31.9

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)