Aloe werneri — The Life Data

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records4

Data sources6

Biological traits10

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Aloe werneri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF4 records

DNA & barcodingNCBIsequences

01Narrative

Aloe werneri ist eine Pflanzenart der Gattung der Aloen in der Unterfamilie der Affodillgewächse (Asphodeloideae). Das Artepitheton werneri ehrt den deutschen Botaniker Werner Rauh, der die Art 1991 entdeckte.Gideon F. Smith, Colin C. Walker, Estrela Figueiredo: What’s in a name: epithets in Aloe L. (Asphodelaceae) and what to call the next new species. In: Bradleya. Band 28, 2010, S. 102.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formsucculent perennial or chamaephyte

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Succulenceyes

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe werneri has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSOL838185.1 ↗379 bp

ACGT

ACAATTACTCTTCTGTAGGTGAACGTGGGGAAGGATCATTGTAGAGACGAGAAAGGGCGACCGCGAACTATTGATCTCTTTACAATGAGC …

Aloe werneri isolate Mauritius small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	2
Plocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1

3 institutions · 4 of 4 vouchered records shown