Aloe vera
(L.) Burm.f. · speciesAt a glance
Occurrence records3 588
Data sources12
Biological traits41
DNA specimens44
eDNA detections29
Sources12 archives
Databases and archives Aloe vera's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 578 records↗
OBISOcean Biodiversity Information System10 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS · NPASS569 compounds
Occurrence & distributionGBIF · OBIS3 588 records
Environmental DNA1 datasets · 4 countries29 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB2n = 14
01Narrative
Aloe vera est une espèce d'aloès, originaire du sultanat d'Oman ; c'est une plante succulente vivace qui pousse principalement dans le désert ou le biome des arbustes secs.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology11
Fruit length13.5 mm
Inflorescence length max80 cm
Inflorescence length min50 cm
Leaf length500 mm
⚠ sources differ — AusTraits: 500 mm · GIFT: 250 mm
Leaf length max600 mm
Leaf length min150 mm
Leaf width max70 mm
Leaf width min40 mm
Plant height0.8 m
⚠ sources differ — GIFT: 0.8 m · AusTraits: 1 m
Plant height max1 m
Plant height min0.5 m
Life cycle & reproduction10
Deciduousnessevergreen
Dispersal typeunspecialized
Flower colouryellow
Flower length max30 mm
Flower length min25 mm
Flowering endDec
Flowering startJan
Life formsucculent perennial
Life spanperennial
Raunkiær life formchamaephyte
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatedesert or dry shrubland
Climberself-supporting
Elevation max2 600 m
Elevation mean1 150 m
Elevation min330 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
⚠ sources differ — GIFT: herb · AusTraits: palmoid · TRY: Herb
Habitat GIFTopen
Leaf shapeensiform
Mycorrhiza typearbuscular
Succulenceyes
Woodinessnon-woody
⚠ sources differ — TRY: non-woody · AusTraits: woody · GIFT: non-woody
Physiology & chemistry3
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayCAM
Specific leaf area (SLA)9.14 mm²/mg
Other traits2
Defenseyes
Leaf arrangementrosette
03Chemical composition569 compounds
Compounds documented for Aloe vera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Anthraquinones and anthrones47
Chromones37
Cinnamic acids and derivatives25
Fatty aldehydes23
Unsaturated fatty acids22
Documented compounds569 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-2,3-Butanediol | present | NPASS | |
| (+)-Valine | present | NPASS | |
| (+-)-2-Hydroxypentanoic acid | present | NPASS | |
| (-)-1,3-Butanediol | present | NPASS | |
| (-)-5,6,7,8-Tetrahydro-3,6,9-trihydroxy-1-methyl-8-oxo-2-anthracenecarboxylic acid methyl ester | present | LOTUS | |
| (-)-Caryophyllene | present | NPASS | |
| (-)-Catechol | present | NPASS | |
| (-)-Linalool | present | NPASS | |
| (-)-Mandelic acid | present | NPASS | |
| (10R)-1,8-dihydroxy-3-(hydroxymethyl)-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-10H-anthracen-9-one | present | LOTUS |
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe vera has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes7
GenBank sequences10
eDNA detections29
Countries5
The DNA barcodea real sequence read deposited for this species
TGCGGAAGGATCATNGTCGAGACCCGAAAAGGACGACCGCGAACCATTGATCTCTTTACAATTAGCGCCCGAGCATCGCTTTGGCGCGAC …
Aloe vera isolate Mauritius-FARC internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★rbcLa★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB
The complete instruction manual Aloe vera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidydiploid inferred
Chromosome records10–142n range14median14mode27records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1426×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +6
CCDB · book-ipcn65 — Vig 1965
CCDB · ipcn-api-dl — Sapre, A. B. 1975. Meiosis and pollen mitosis in Aloe barbadensis Mill. (A. perfoliata var. vera L., A. vera Auth. non Mill.). Cytologia 40: 525–533.
CCDB · ipcn-api-dl — Sapre, A. B. 1978. Karyotype of Aloe barbadensis Mill.: A reinvestigation. Cytologia 43: 237–241.
CCDB · ipcn-api-dl — Ayyangar, K. R. & R. Sampathkumar. 1975. Meiotic studies in Crotalaria. Proc. Indian Sci. Congr. Assoc. 62: 114.
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Studies in south Indian Liliaceae: III. Cytology of twelve species of Aloe. New Bot. 17: 255–266.
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.
CCDB · ipcn-api-dl — Adams, S. P., I. J. Leitch, M. D. Bennett, M. W. Chase & A. R. Leitch. 2000. Ribosomal DNA evolution and phylogeny in Aloe (Asphodelaceae). Amer. J. Bot. 87(11): 1578–1583.
CCDB · ipcn-api-dl — Imery, J. & H. Cequea. 2001. Colchicine-induced autotetraploid in Aloe vera L. Cytologia 66: 409–413.
CCDB · ipcn-api-dl — Umesh, T. G. & R. M. Ranganath. 2003. Ultrastructural evidence for the flawless transmission on dicentric chromosome in Aloe vera L. Cytologia 68: 211–217.
CCDB · ipcn-api-dl — VIJ, S. P. & MADHU. 1976. Cytological studies in Aloe L. Proc. Indian Sci. Congr. Assoc. 63: 129.
CCDB · ipcn-api-dl — Chen, R. y., W. q. Song, X. l. Li, M. x. Li, G. l. Liang & C. b. Chen. 2003. Chromosome Atlas of Major Economic Plants Genome in China, Vol. 3, Chromosome Atlas of Garden Flowering Plants in China. Science Press, Beijing.
CCDB · ipcn-api-dl — Zheng. 2005. Karyotype analysis of 14 species and varieties in Aloe L. J. Wuhan Bot. Res. 23(6): 535–540.
CCDB · ipcn-api-dl — Ma, X. H., R. L. Qin & W. B. Xing. 1985. Chromosome observation of twenty species of drug plants in Xingjiang. Acta Bot. Boreal.-Occid. Sin. 5: 149–154.
CCDB · book-ipcn75-78 — Sa pre 1975
CCDB · book-ipcn75-78 — Ayyanger & Sampathkumar 1976
CCDB · book-ipcn75-78 — Sa pre 1978
CCDB · book-indian_vol2 — Mitra, K. 1964 ; Kaul, B.L. 1964 ; Sapre, A.B. 1975, 1977a,b, 1978a ; Ayyangar, K.R. & Sampathkumar, R. 1976
CCDB · book-indian_vol2 — Sutaria, R.N. 1932 ; Marshak, A. 1934; Resende, F. 1937; Resende, F. & Rijo, L. 1948 ; Sharma, A.K. & Cbatterji, A.K. 1958a, b ; Mehra, P.N. & Malik, C.P. 1961c; Vij, S.P. & Madhu 1976
CCDB · eflora
CCDB · book-fedorov — Mitra K. 1964
CCDB · book-fedorov — Kaul 1964
CCDB · book-atlas-flowering-plants — Marshak 1934
CCDB · kew — Zonneveld BJM. Genome size analysis of selected species of Aloe (Aloaceae) reveals the most primitive species and results in some new combinations. Bradleya 20: 5-12
CCDB · Cave1958 — Sharma & Chatterji '58
2n 212×CCDB · ipcn-api-dl · CCDB · book-indian_vol2
CCDB · ipcn-api-dl — Abraham, Z. & P. N. Prasad. 1979. Occurrence of triploidy in Aloe vera Tourn. ex Linn. Curr. Sci. 48: 1001 – 1002.
CCDB · book-indian_vol2 — Abraham, Z. & Prasad, ~.N. 1979
2n 51×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — 7
2n 101×CCDB · book-indian_vol2
CCDB · book-indian_vol2 — Vig, B.K. 1965
n 74×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sapre, A. B. 1978. Karyotype of Aloe barbadensis Mill.: A reinvestigation. Cytologia 43: 237–241.
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Studies in south Indian Liliaceae: III. Cytology of twelve species of Aloe. New Bot. 17: 255–266.
CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.
CCDB · ipcn-api-dl — VIJ, S. P., M. Sharma & I. S. Toor. 1980. Cytogenetical investigations into some garden ornamentals II. The genus Aloe L. Cytologia 45: 515–532.
n 31×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — 7
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 588 records
Wild obs. + sensor2 954
Museum / vouchered577
Cultivated / captive18
Other39
Origin
Native56
Introduced104
Range
Area of Occupancy AOO9 440 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 1 440≤1 km 521≤10 km 271>10 km 121
2 353 georeferenced · 601 without coordinates
Open the mapobservation + sensor2 954
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy82% within 1 km
≤100 m 109≤1 km 17≤10 km 23>10 km 5
154 georeferenced · 423 without coordinates
Open the institutions mapphysical evidence577
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy50% within 1 km
≤100 m 4≤1 km 2≤10 km 6
12 georeferenced · 6 without coordinates
Open the mapnot free-living18
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions75 of 141 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Chicago, US | 39 |
| Chapingo, MX | 36 |
| Durango, MX | 33 |
| Bronx, US | 23 |
| Saint Louis, US | 23 |
| Salvador, BR | 13 |
| Mexico City, MX | 12 |
| Mérida, MX | 11 |
| Puerto Ayora, EC | 8 |
| UFBAlocation not on record | 8 |
| BISHlocation not on record | 6 |
| Honolulu, US | 6 |
| Altos de Pipe, VE | 6 |
| UEPAlocation not on record | 6 |
| Leiden University Medical Centerlocation not on record | 6 |
| Kew, GB | 5 |
| Ann Arbor, US | 5 |
| BIO-UNIPIlocation not on record | 5 |
| Miami, US | 4 |
| UTPLlocation not on record | 4 |
| Ilhéus, BR | 4 |
| Edinburgh, GB | 4 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 4 |
| ASUlocation not on record | 4 |
| Maringá, BR | 4 |
| Universidad de Caldas (UCaldas)location not on record | 4 |
| Blumenau, BR | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Tampa, US | 3 |
| Universidad Industrial de Santander (UIS)location not on record | 3 |
| Wlocation not on record | 3 |
| Christchurch, NZ | 3 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 3 |
| Istituto Agrario Castelnuovolocation not on record | 3 |
| UFOPlocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| León, NI | 3 |
| Alicante, ES | 3 |
| La Paz, MX | 3 |
| Antiguo Cuscatlán, SV | 3 |
| Claremont, US | 3 |
| Universidad del Quindío (UniQuindío)location not on record | 3 |
| JBRJlocation not on record | 3 |
| Kunming, CN | 3 |
| Paris, FR | 2 |
| Mexico City, MX | 2 |
| Palmerston, AU | 2 |
| BDBClocation not on record | 2 |
| Cascavel, BR | 2 |
| Loja, EC | 2 |
| Universidad Pedagógica y Tecnológica de Colombia (UPTC)location not on record | 2 |
| Universidad Nacional de Colombia (UNAL)location not on record | 2 |
| National Institute for Agricultural and Veterinarian Research, Portugallocation not on record | 2 |
| UFMSlocation not on record | 2 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 2 |
| Millersville, US | 2 |
| Santa Barbara, US | 2 |
| San Diego, US | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Masindi, UG | 2 |
| Tlalnepantla, MX | 2 |
| Museo Nacional de Costa Rica (MNCR)location not on record | 2 |
| Fredericksburg, US | 2 |
| Laboratorio de Ictiologialocation not on record | 2 |
| Fortaleza, BR | 2 |
| South Kensington, GB | 2 |
| National Biodiversity Institute, Costa Ricalocation not on record | 2 |
| Cambridge, US | 2 |
| Porto Velho, BR | 2 |
| Teresina, BR | 2 |
| UNEMATlocation not on record | 2 |
| Coimbra, PT | 2 |
| Departamento de Sistematica e Ecologialocation not on record | 2 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Pullman, US | 1 |
| Chaguaramas, TT | 1 |
| 云南省思茅市民族传统医药研究所location not on record | 1 |
| Montréal, CA | 1 |
| University of Hawaii at Manoalocation not on record | 1 |
| Badajoz, ES | 1 |
| Feira de Santana, BR | 1 |
| HAWlocation not on record | 1 |
| UNIVASFlocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| *unvoucheredlocation not on record | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Universidad Autónoma de Nayaritlocation not on record | 1 |
| Sevilla, ES | 1 |
| BClocation not on record | 1 |
| GB | 1 |
| UPNlocation not on record | 1 |
| UFRRJlocation not on record | 1 |
| Cape Town, ZA | 1 |
| Santa Teresa, BR | 1 |
| Hobart, AU | 1 |
| Foz do Iguaçu, BR | 1 |
| Muzaffarabad, PK | 1 |
| Pretoria, ZA | 1 |
| UNESP-IBILCElocation not on record | 1 |
| MEXUlocation not on record | 1 |
| UNAN-LEONlocation not on record | 1 |
| Barcelona, ES | 1 |
| Pondicherry, IN | 1 |
| FLASlocation not on record | 1 |
| Ciudad de México, MX | 1 |
| JBSlocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| San Isidro, AR | 1 |
| INMAlocation not on record | 1 |
| Seropédica, BR | 1 |
| Hermosillo, MX | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| QCNElocation not on record | 1 |
| FUVATESlocation not on record | 1 |
| Universidade Federal de Sergipe (UFS)location not on record | 1 |
| HUENFlocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record | 1 |
| Corporación Autónoma Regional Para la Defensa de la Meseta de Bucaramanga (CDMB)location not on record | 1 |
| Uberlândia, BR | 1 |
| WTUlocation not on record | 1 |
| CMULlocation not on record | 1 |
| Baroda, IN | 1 |
| Phoenix, US | 1 |
| UFVJMlocation not on record | 1 |
| Puebla, MX | 1 |
| Uppsala, SE | 1 |
| Cenargenlocation not on record | 1 |
| Canberra, AU | 1 |
| Guilin, CN | 1 |
| Centre for Medicinal Plants Research-Arya Vaidya Salalocation not on record | 1 |
| Brasília, BR | 1 |
| Tuxtla Gutiérrez, MX | 1 |
| LNBG$location not on record | 1 |
| BAYLUlocation not on record | 1 |
| Bangkok, TH | 1 |
| Fort Worth, US | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Orem, US | 1 |
141 institutions · 470 of 577 vouchered records shown · 98 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Aloe vera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map4 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median23.4 °C 16.5–26.3
Seasonal swing summer↔winter10.2 °C
Max temp (day)27.2 °C 19.7–30.8
Min temp (night)16.9 °C 12.5–24.4
Precipitation39.8 mm/mo 12.2–221
Air humidity62.0 % 47.6–66.4
Moisture balance-11.1 mm/mo
Vapour deficit1,125 Pa 685–1,505
Wind speed3.50 m/s
Cloud cover32.4 % 20.8–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 8 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.