Aloe humilis

(L.) Mill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records65

Data sources10

Biological traits15

DNA specimens7

eDNA detections4

Sources10 archives

Databases and archives Aloe humilis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility65 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF65 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aloe humilis est une espèce de plantes à fleurs de la famille des Xanthorrhoeaceae, selon APG III, des Asphodelaceae, selon APG IV. C'est une plante grasse ornementale.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.15 m

Plant height min0.07 m

Life cycle & reproduction3

Life formsucculent perennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 675 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition1 compounds

Compounds documented for Aloe humilis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthraquinones and anthrones1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Chrysophanol		present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe humilis has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences7

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAY323675.1 ↗251 bp

ACGT

TCGAGACCCGAAAGGACGACCGCGAACCATTGATCTCTTTACAATGAGCGCCCGAGCATCGCTTCGGCGTGACGCCTATCGCCCCGATAT …

Aloe humilis internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL2★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Aloe humilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 149×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-indian_vol2 +3

CCDB · ipcn-api-dl — VIJ, S. P., M. Sharma & I. S. Toor. 1980. Cytogenetical investigations into some garden ornamentals II. The genus Aloe L. Cytologia 45: 515–532.

CCDB · ipcn-api-dl — Vosa, C. G. 1981. Chromosome studies in the Southern African Flora: 4-6. J. S. African Bot. 47: 7–10.

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

CCDB · book-indian_vol2 — Geitler, L. 1935 ; Resende, F. 1937 ; Sato, D~ 1937a, 1942 ; Brandham, P.E. 1971 ; Vij, S.P. et al. 1980

CCDB · book-atlas-flowering-plants — Sato 1942

CCDB · kew — Zonneveld BJM. Genome size analysis of selected species of Aloe (Aloaceae) reveals the most primitive species and results in some new combinations. Bradleya 20: 5-12

CCDB · Oberlander2016 — Vosa, 1981;Vij, Sharma & Toor, 1980

2n 212×CCDB · book-ipcn67-71 · CCDB · book-indian_vol2

CCDB · book-ipcn67-71 — SHARMA, A. K., & R. MALLICK. 1966. Interrelationships and evolution of the tribe Aloineae as reflected in its cytology. Jour. Genet. 59: 20-47.

CCDB · book-indian_vol2 — Sharma, A.K. & Mallick, R. 1961 (Mitra, K. 1964) ; Sharma, A.K. & Mallick, R. 1966

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type65 records

Wild obs. + sensor42

Museum / vouchered22

Cultivated / captive1

Origin

Introduced5

Range

Area of Occupancy AOO200 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 14≤1 km 12>10 km 12

38 georeferenced · 4 without coordinates

Open the mapobservation + sensor42

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 1≤1 km 2>10 km 1

4 georeferenced · 18 without coordinates

Open the institutions mapphysical evidence22

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	8
Cape Town, ZA	6
Santa Barbara, US	3
Research Collection of Bruce Bayerlocation not on record	1
Moscow State Universitylocation not on record	1
Bangkok, TH	1

6 institutions · 20 of 22 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 detections

Where the DNA of Aloe humilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 14.9–14.9

Seasonal swing summer↔winter11.0 °C

Max temp (day)21.4 °C

Min temp (night)9.20 °C

Precipitation29.1 mm/mo

Air humidity54.0 %

Moisture balance-40.9 mm/mo

Vapour deficit777 Pa

Wind speed2.90 m/s

Cloud cover10.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)