Aloe harlana

Reynolds · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records24

Data sources11

Biological traits9

DNA specimens4

eDNA detections1

Sources11 archives

Databases and archives Aloe harlana's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility24 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources9 traits

Chemical compositionLOTUS12 compounds

Occurrence & distributionGBIF24 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aloe harlana is a species of Aloe found in eastern Ethiopia. It was first described by Gilbert Reynolds in 1957.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

03Chemical composition12 compounds

Compounds documented for Aloe harlana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Anthraquinones and anthrones7

Phenylethylamines2

Naphthoquinones1

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3,4-Dihydro-3,6,9-trihydroxy-8-methylanthracen-1(2h)-one	present	LOTUS
(-)-5,6,7,8-Tetrahydro-3,6,9-trihydroxy-1-methyl-8-oxo-2-anthracenecarboxylic acid methyl ester	present	LOTUS
(4S)-3,4-Dihydro-4,8,9-trihydroxy-6-methylanthracen-1(2H)-one	present	LOTUS
4-Methoxy-N-methylbenzeneethanamine	present	LOTUS
Aloechrysone	present	LOTUS
Aloesaponarin I	present	LOTUS
Aloesaponarin II	present	LOTUS
Aloin B	present	LOTUS
Asphodelin	present	LOTUS
Barbaloin	present	LOTUS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe harlana has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes5

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOL536354.1 ↗349 bpUSA · 2018

ACGT

TTTGACGCAAGTTGCGCCCGAGGCCACCCGGCCGAGGGCACGCCTGCCTGGGCGTCACGCCTCGCGTCGCTCTGCCTACCTCGCCCTGAG …

Aloe harlana voucher MO:Carlsen3228 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS2★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Aloe harlana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 141×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type24 records

Museum / vouchered24

Range

Area of Occupancy AOO48 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 24 records without

Open the institutions mapphysical evidence24

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	14
University of Stellenboschlocation not on record	3
Saint Louis, US	1
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

4 institutions · 19 of 24 vouchered records shown · 5 without an institution code

09Environmental DNA1 detections

Where the DNA of Aloe harlana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.6 °C 13.6–13.6

Seasonal swing summer↔winter26.3 °C

Max temp (day)19.5 °C

Min temp (night)8.70 °C

Precipitation114 mm/mo

Air humidity54.5 %

Moisture balance0.9 mm/mo

Vapour deficit709 Pa

Wind speed4.00 m/s

Cloud cover44.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)