Aloe divaricata

A.Berger · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records191

Data sources12

Biological traits18

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Aloe divaricata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility191 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources18 traits

Chemical compositionLOTUS2 compounds

Occurrence & distributionGBIF191 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aloe divaricata ist eine Pflanzenart der Gattung der Aloen in der Unterfamilie der Affodillgewächse (Asphodeloideae). Das Artepitheton divaricata stammt aus dem Lateinischen, bedeutet ‚ausgespreizt‘ und verweist auf die Verzweigungen des Blütenstandes.Urs Eggli, Leonard E. Newton: Etymological Dictionary of Succulent Plant Names. Springer, Berlin/Heidelberg 2010, ISBN 978-3-642-05597-3, S. 68.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height3 m

Seed mass0.782 mg

Seed mass max0.78 mg

Seed mass min0.78 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formsucculent subshrub or shrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Succulenceyes

Woodinessvariable

⚠ sources differ — TRY: woody/nonwoody · GIFT: woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition2 compounds

Compounds documented for Aloe divaricata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Anthraquinones and anthrones2

Documented compounds2 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Aloin B		present	LOTUS
Barbaloin		present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe divaricata has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences5

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSOL823116.1 ↗345 bp

ACGT

GGAAGGATCATTGTCGAGACCCGAAAGGACGACCGCGAACCATTGATCTCTTTACAATGAGCGCCCGAGCATCGCTTTGGCGCTACGCCT …

Aloe divaricata isolate Mauritius internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aloe divaricata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–282n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Amano, M., Y. TAKAHASHL & N. KONDO. 1972a. A comparative karyotype study in Madagascan Aloes. Rep. Inst. Breed. Res. Tokyo Univ. Agr. 3: 7–12.

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

CCDB · book-ipcn75-78 — Amano et al. 1972a

2n 282×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Amano, M., Y. TAKAHASHL & N. KONDO. 1972a. A comparative karyotype study in Madagascan Aloes. Rep. Inst. Breed. Res. Tokyo Univ. Agr. 3: 7–12.

CCDB · book-ipcn75-78 — Amano et al. 1972a

n 71×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Rabakonandrianina, E. & G. D. Carr. 1987. Chromosome numbers of Madagascar plants. Ann. Missouri Bot. Gard. 74: 123–125.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type191 records

Wild obs. + sensor125

Museum / vouchered66

Range

Area of Occupancy AOO448 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 67≤1 km 10≤10 km 11>10 km 12

100 georeferenced · 25 without coordinates

Open the mapobservation + sensor125

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	40
Kew, GB	16
Plocation not on record	2
Bronx, US	1
Chicago, US	1
Saint Louis, US	1
MeiseBGlocation not on record	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1
South Kensington, GB	1

9 institutions · 64 of 66 vouchered records shown · 2 without an institution code

09Environmental DNA1 detections

Where the DNA of Aloe divaricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)