Aloe descoingsii

Reynolds · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records9

Data sources13

Biological traits11

DNA specimens1

eDNA detections1

Sources13 archives

Databases and archives Aloe descoingsii's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility9 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionDukesPhytochem · LOTUS5 compounds

Occurrence & distributionGBIF9 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aloe descoingsii is a species of Aloe native to Madagascar. Regarded as the smallest Aloe species in the world, it generally reaches a maximum of about 3 inches (7.62cm) across. With white spotted leaves, A. descoingsii grows via offsets in clumps and sports tiny orange flowers.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Succulenceyes

Woodinessnon-woody

03Chemical composition5 compounds

Compounds documented for Aloe descoingsii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile2 classes

Acetate-derived alkaloids2

Acetate-derived alkaloids $ Piperidine alkaloids2

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Coniine	present	LOTUS
(2R)-2-Propylpiperidine	present	LOTUS
2,3,4,5-Tetrahydro-6-propylpyridine	present	LOTUS
Conhydrine	present	LOTUS
CONIINE	present	DukesPhytochem

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe descoingsii has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences2

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMG776039.1 ↗656 bp

ACGT

GACCGAAGGAGACCGCGAACCATTGATCTCTTTACAATGAGCGCCCTAGCATCGCTTCGGCGCGACGTCTATCGCCCCGATATGCCATCC …

Aloe descoingsii voucher RSE737 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aloe descoingsii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 142×CCDB · ipcn-api-dl · CCDB · kew

CCDB · ipcn-api-dl — Zheng. 2005. Karyotype analysis of 14 species and varieties in Aloe L. J. Wuhan Bot. Res. 23(6): 535–540.

CCDB · kew — Zonneveld BJM. Genome size analysis of selected species of Aloe (Aloaceae) reveals the most primitive species and results in some new combinations. Bradleya 20: 5-12

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type9 records

Wild obs. + sensor1

Museum / vouchered7

Cultivated / captive1

Range

Area of Occupancy AOO20 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 7 records without

Open the institutions mapphysical evidence7

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	2
Bangkok, TH	2
Kew, GB	1
Saint Louis, US	1

4 institutions · 6 of 7 vouchered records shown · 1 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Aloe descoingsii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)