Aloe cryptopoda

Baker · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records125

Data sources9

Biological traits21

DNA specimens0

eDNA detections0

Sources9 archives

Databases and archives Aloe cryptopoda's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility125 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources21 traits

Chemical compositionLOTUS5 compounds

Occurrence & distributionGBIF125 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

Aloe cryptopoda, is a species of flowering plant in the Asphodelaceae family. It is found in S.E. Tanzania to Botswana.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height1 m

Plant height max2.74 m

Plant height min0.91 m

Seed mass1.85 mg

Seed mass max1.85 mg

Seed mass min1.72 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formsucculent perennial or chamaephyte

Life spanperennial

Lifeform raunkiaer detailedchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Elevation max1 220 m

Elevation min460 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition5 compounds

Compounds documented for Aloe cryptopoda across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Anthraquinones and anthrones2

Naphthoquinones1

Documented compounds5 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-3,4-Dihydro-3,6,9-trihydroxy-8-methylanthracen-1(2h)-one	present	LOTUS
(-)-5,6,7,8-Tetrahydro-3,6,9-trihydroxy-1-methyl-8-oxo-2-anthracenecarboxylic acid methyl ester	present	LOTUS
(4S)-3,4-Dihydro-4,8,9-trihydroxy-6-methylanthracen-1(2H)-one	present	LOTUS
2,8-dihydroxy-1-methoxy-6-methyl-10-[(2S,3R,4R,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-10H-anthracen-9-one	present	LOTUS
Aloechrysone	present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe cryptopoda has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKF013271.1 ↗529 bp

ACGT

CCCCCCCGGCGCGATGGGCGCCAAGGAACACAGCGGTCGGAGGGAGGCGGCGGTGCTCCTAGCTATACGGCTTGGAGCGTCCGCCCCGCC …

Aloe cryptopoda isolate P7633 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aloe cryptopoda carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×CCDB · book-ipcn65 · CCDB · book-ipcn67-71 · CCDB · book-fedorov +2

CCDB · book-ipcn65 — Sharma & M. 1965

CCDB · book-ipcn67-71 — SHARMA, A. K., & R. MALLICK. 1966. Interrelationships and evolution of the tribe Aloineae as reflected in its cytology. Jour. Genet. 59: 20-47.

CCDB · book-fedorov — Riley H. P. 1959a

CCDB · kew — Zonneveld BJM. Genome size analysis of selected species of Aloe (Aloaceae) reveals the most primitive species and results in some new combinations. Bradleya 20: 5-12

CCDB · Cave1959 — Riley 1959b

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type125 records

Wild obs. + sensor15

Museum / vouchered110

Range

Area of Occupancy AOO232 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 7≤1 km 3>10 km 2

12 georeferenced · 3 without coordinates

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 5>10 km 1

7 georeferenced · 103 without coordinates

Open the institutions mapphysical evidence110

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Cape Town, ZA	40
Kew, GB	30
Phoenix, US	8
Pretoria, ZA	5
South African National Biodiversity Institutelocation not on record	3
MSB-3054location not on record	3
Riverside, US	2
Instituto de Investigação Científica Tropicallocation not on record	2
LNBG$location not on record	2
MAlocation not on record	1
Durban, ZA	1
MeiseBGlocation not on record	1
BClocation not on record	1

13 institutions · 99 of 110 vouchered records shown · 11 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)