Aloe brevifolia

Mill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records52

Data sources9

Biological traits15

DNA specimens6

eDNA detections2

Sources9 archives

Databases and archives Aloe brevifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF52 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Ало́э коротколи́стное — растение из рода Алоэ (Aloe) семейства Асфоделовые. Листья собраны в розетку, в ней содержится 30—40 листьев. Форма ланцетная, длина 7—11 см, ширина у основания 2,5 см. Пятна и полосы отсутствуют. Снизу листья плоские, в верхней части с шипами, ширина листа посередине 0,6—0,9 см. Шипы находятся по краям листа, беловатого цвета, длина 0,2—0,3 см. Цветонос достигает в высоту 30 см, на нём расположены кроющие листья. Соцветие — кисть, плотная, длина 15 см, ширина 8 см. Цветки расположены на небольших цветоножках длиной 1,2—2,5 см, красного цвета. Длина цветков 3—3,5 см. Алоэ коротколистное распространено в Западной Капской области Южной Африки. Естественные места обитания — холмистые саванны.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.3 m

Plant height min0.1 m

Life cycle & reproduction3

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max100 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe brevifolia has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes5

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSJQ025314.1 ↗427 bp

ACGT

TATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGAAAGGACGACCGCGA …

Aloe brevifolia voucher BHD460 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL3★rbcLa★ITS2trnH-psbA

plant barcodefungal barcodemarker

06Genome at a glanceCCDB

The complete instruction manual Aloe brevifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1411×CCDB · book-ipcn65 · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4

CCDB · book-ipcn65 — Sharma & M. 1965

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Studies in south Indian Liliaceae: III. Cytology of twelve species of Aloe. New Bot. 17: 255–266.

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.

CCDB · book-ipcn67-71 — SHARMA, A. K., & R. MALLICK. 1966. Interrelationships and evolution of the tribe Aloineae as reflected in its cytology. Jour. Genet. 59: 20-47.

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

CCDB · book-fedorov — Resende 1937a

CCDB · book-fedorov — SatO D. 1937a, 1.942

CCDB · book-fedorov — Snoad 1951

CCDB · book-atlas-flowering-plants

CCDB · kew — Zonneveld BJM. Genome size analysis of selected species of Aloe (Aloaceae) reveals the most primitive species and results in some new combinations. Bradleya 20: 5-12

CCDB · Oberlander2016 — Vijayavalli & Mathew, 1990

n 72×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Studies in south Indian Liliaceae: III. Cytology of twelve species of Aloe. New Bot. 17: 255–266.

CCDB · ipcn-api-dl — Vijayavalli, B. & P. M. Mathew. 1990. Cytotax. Liliaceae Allied Fam. Continental Publishers, Kerala, India.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type52 records

Wild obs. + sensor29

Museum / vouchered22

Cultivated / captive1

Origin

Native1

Introduced2

Range

Area of Occupancy AOO172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 2≤1 km 2>10 km 25

29 georeferenced

Open the mapobservation + sensor29

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 2≤1 km 6≤10 km 1

9 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence22

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	3
Adelaide, AU	3
Riverside, US	2
València, ES	2
Research Collection of Bruce Bayerlocation not on record	1
University of Johannesburglocation not on record	1
Mount Annan, AU	1
Museo Entomologico de Leonlocation not on record	1
Claremont, US	1
Kensington, AU	1
Saint Louis, US	1
Chongqing Museumlocation not on record	1
Auckland, NZ	1
San Diego, US	1

14 institutions · 20 of 22 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Aloe brevifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 9.60–17.4

Seasonal swing summer↔winter10.6 °C

Max temp (day)19.6 °C 15.8–23.5

Min temp (night)7.80 °C 4.20–11.4

Precipitation42.2 mm/mo 28.6–55.9

Air humidity51.9 % 51.4–52.4

Moisture balance-54.3 mm/mo -57.1–-51.5

Vapour deficit783 Pa 596–970

Wind speed3.60 m/s 2.10–5.10

Cloud cover15.1 % 11.6–18.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)