Aloe bellatula

Reynolds · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records4

Data sources10

Biological traits11

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Aloe bellatula's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources11 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF4 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 14

01Narrative

miniatur|Blüten Aloe bellatula ist eine Pflanzenart der Gattung der Aloen in der Unterfamilie der Affodillgewächse (Asphodeloideae). Das Artepitheton bellatula leitet sich von der Verkleinerungsform des lateinischen Wortes bellus ab und bedeutet ‚schön‘.Urs Eggli, Leonard E. Newton: Etymological Dictionary of Succulent Plant Names. Springer, Berlin/Heidelberg 2010, ISBN 978-3-642-05597-3, S. 24.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction3

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Succulenceyes

Woodinessnon-woody

03Chemical composition1 compounds

Compounds documented for Aloe bellatula across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Phenylethylamines1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
N-Methyltyramine		present	LOTUS

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe bellatula has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences2

The DNA barcodea real sequence read deposited for this species

ITSKF013262.1 ↗529 bp

ACGT

CCCCCCCGGCGCGATGGGCGCCAAGGAACACAGCGGTCGGAGGGAGGGGGCGGTGCTCCTAGCTATATGGCTTGGAACGTCCGCCCCGCC …

Aloe bellatula isolate P8195 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aloe bellatula carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 143×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · kew

CCDB · ipcn-api-dl — Amano, M., Y. TAKAHASHL & N. KONDO. 1972a. A comparative karyotype study in Madagascan Aloes. Rep. Inst. Breed. Res. Tokyo Univ. Agr. 3: 7–12.

CCDB · book-ipcn75-78 — Amano et al. l 972a

CCDB · kew — Zonneveld BJM. Genome size analysis of selected species of Aloe (Aloaceae) reveals the most primitive species and results in some new combinations. Bradleya 20: 5-12

n 71×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 records

Museum / vouchered4

Range

Area of Occupancy AOO8 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	3

1 institutions · 3 of 4 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)