Aloe bakeri

Scott Elliot · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records17

Data sources10

Biological traits11

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Aloe bakeri's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS4 compounds

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Алоэ Бейкера — суккулентное травянистое растение; вид рода Алоэ (Aloe) подсемейства Асфоделовые (Asphodelaceae) семейства Ксанторреевые (Xanthorrhoeaceae). Видовое название дано в честь Джона Гилберта Бейкера (1834—1920), английского ботаника, который работал в библиотеке и гербарии Королевских ботанических садов в Кью (Лондон). Побеги до 20 см высотой, полегающие, обильно разветвлённые от основания. Листья 5-10 см длиной, узкие, менее 1 см в ширину, сочные, жёсткие, изогнутые, в той или иной степени коричнево-зелёные с розово-коричневыми полосами. Часто имеют пятна на внешней поверхности. По краям вооружённые мягкими белыми шипами 1 мм длиной, расположенными на расстоянии 1-2 мм друг от друга. Цветки трубчатые, 3-4 см длиной, оранжевого или жёлтого цвета, у основания красные, расположены в кистях на длинном одиночном цветоносе. Вид является эндемиком Мадагаскара, где растёт в песчаных дюнах вблизи Форт-Дофин в провинции Тулиара. Вид внесён в Приложение II Конвенции о международной торговле дикими видами фауны и флоры, находящимися под угрозой исчезновения (CITES).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formsucculent subshrub

Life spanperennial

Raunkiær life formchamaephyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climateseasonally dry tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Succulenceyes

Woodinessnon-woody

03Chemical composition4 compounds

Compounds documented for Aloe bakeri across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Anthraquinones and anthrones2

Phenylethylamines1

Documented compounds4 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-5,6,7,8-Tetrahydro-3,6,9-trihydroxy-1-methyl-8-oxo-2-anthracenecarboxylic acid methyl ester	present	LOTUS
1,8-Dihydroxy-3-(hydroxymethyl)-9(10H)-anthracenone	present	LOTUS
Chrysophanol	present	LOTUS
N-Methyltyramine	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe bakeri has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF234346.1 ↗681 bp

ACGT

CTGCGGAAGGATCATTGTCGAGACCCGAAAGGACGACCGCGAACCATTGATCTCTTTACAATGAGCGCCCGAGCATCGCTTCGGCGCGAC …

Aloe bakeri internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aloe bakeri carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 144×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · kew

CCDB · ipcn-api-dl — Adams, S. P., I. J. Leitch, M. D. Bennett, M. W. Chase & A. R. Leitch. 2000. Ribosomal DNA evolution and phylogeny in Aloe (Asphodelaceae). Amer. J. Bot. 87(11): 1578–1583.

CCDB · ipcn-api-dl — Amano, M., Y. TAKAHASHL & N. KONDO. 1972a. A comparative karyotype study in Madagascan Aloes. Rep. Inst. Breed. Res. Tokyo Univ. Agr. 3: 7–12.

CCDB · book-ipcn75-78 — Amano et al. l 972a

CCDB · kew — Zonneveld BJM. Genome size analysis of selected species of Aloe (Aloaceae) reveals the most primitive species and results in some new combinations. Bradleya 20: 5-12

n 71×CCDB · book-ipcn67-71

CCDB · book-ipcn67-71 — BRANDHAM, P.E. 1971. Chromosomes of the Liliaceae II, Polyploidy and karyotype variation in the Aloineae. Kew Bull. 25: 381-399.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type17 records

Wild obs. + sensor1

Museum / vouchered16

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 14 without coordinates

Open the institutions mapphysical evidence16

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	5
Kew, GB	3
Riverside, US	2
Plocation not on record	1
Phoenix, US	1
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	1
Saint Louis, US	1
Bangkok, TH	1

8 institutions · 15 of 16 vouchered records shown · 1 without an institution code

09Environmental DNA3 detections

Where the DNA of Aloe bakeri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)