Aloe africana

Mill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Asphodelaceae/Aloe

At a glance

Occurrence records866

Data sources11

Biological traits23

DNA specimens2

eDNA detections1

Sources11 archives

Databases and archives Aloe africana's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility866 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Chemical compositionLOTUS · NPASS330 compounds

Occurrence & distributionGBIF866 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 14

01Narrative

Aloe africana est une espèce arborescente d'aloès originaire de la région du Cap-Oriental, en Afrique du Sud.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height2 m

Plant height max4 m

Plant height min2 m

Seed mass1.6 mg

Seed mass max1.56 mg

Seed mass min1.56 mg

Life cycle & reproduction6

Deciduousnessevergreen

Life formsucculent shrub or tree

Life spanperennial

Pollination modebiotic

Pollination syndromebird

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max300 m

Elevation min75 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: variable

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition330 compounds

Compounds documented for Aloe africana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Anthraquinones and anthrones34

Fatty alcohols25

Cinnamic acids and derivatives25

Fatty aldehydes23

Hydroxy fatty acids20

Documented compounds330 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-2,3-Butanediol	present	NPASS
(+)-Valine	present	NPASS
(+-)-2-Hydroxypentanoic acid	present	LOTUS
(+-)-Citramalic acid	present	LOTUS
(-)-1,3-Butanediol	present	NPASS
(-)-Catechol	present	NPASS
(-)-Linalool	present	NPASS
(-)-Mandelic acid	present	NPASS
(10R)-1,8-dihydroxy-3-(hydroxymethyl)-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]-10H-anthracen-9-one	present	LOTUS
(2S,3R,4R,5S,6R)-2-[(9R)-4,5-dihydroxy-2-(hydroxymethyl)-9H-xanthen-9-yl]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloe africana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences5

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHQ646951.1 ↗249 bp

ACGT

TCGAGACCCGAAAGGACGACCGCGAACCATTGATCTCTTTACAATGAGCGCCCGAGCATCGCTTCGGCGCGACGCCTATCGCCCCGATAT …

Aloe africana voucher SR&TDS629/8 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★rbcLa★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Aloe africana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidydiploid inferred

Chromosome records14–142n range14median14mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 145×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 · CCDB · book-indian_vol2 +1

CCDB · ipcn-api-dl — VIJ, S. P., M. Sharma & I. S. Toor. 1980. Cytogenetical investigations into some garden ornamentals II. The genus Aloe L. Cytologia 45: 515–532.

CCDB · ipcn-api-dl — VIJ, S. P. & MADHU. 1976. Cytological studies in Aloe L. Proc. Indian Sci. Congr. Assoc. 63: 129.

CCDB · book-ipcn75-78 — Vij & Madhu 1976

CCDB · book-indian_vol2 — Vij, S.P. et al. 1980

CCDB · Oberlander2016 — Vij, Sharma & Toor, 1980

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type866 records

Wild obs. + sensor834

Museum / vouchered32

Range

Area of Occupancy AOO1 060 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 600≤1 km 25≤10 km 16>10 km 8

649 georeferenced · 185 without coordinates

Open the mapobservation + sensor834

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 32 records without

Open the institutions mapphysical evidence32

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	16
Cape Town, ZA	7
Durban, ZA	4
MSB-3054location not on record	2
University of Johannesburglocation not on record	1
South African National Biodiversity Institutelocation not on record	1

6 institutions · 31 of 32 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Aloe africana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 19.2–19.2

Seasonal swing summer↔winter6.60 °C

Max temp (day)23.1 °C

Min temp (night)16.1 °C

Precipitation40.7 mm/mo

Air humidity60.9 %

Moisture balance-63.5 mm/mo

Vapour deficit871 Pa

Wind speed4.10 m/s

Cloud cover16.6 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)