Aloa lactinea

(Cramer, 1777) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Aloa

At a glance

Occurrence records326

Data sources6

Biological traits0

DNA specimens20

eDNA detections21

Sources6 archives

Databases and archives Aloa lactinea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility326 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF326 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD20 specimens

01Narrative

Aloa lactinea, the red costate tiger moth, is a moth of family Erebidae. The species was first described by Pieter Cramer in 1777. It is found in India, Japan, southern and western China, Taiwan, Java, Sumatra, Sri Lanka, Myanmar and the Philippines.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aloa lactinea has left across the world's sequence archives.

At a glance

DNA specimens20

BINs1

Marker genes1

eDNA detections21

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.14%

Haplotypes1

BIN1

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAACCCCTGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aloa marginatasame genus3.5%Aloa costalissame genus4.4%Creataloum arabicumsame family4.9%Spilosoma vaganssame family5.2%Spilosoma pteridissame family5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type326 records

Wild obs. + sensor307

Museum / vouchered19

Range

Area of Occupancy AOO1 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 83≤1 km 57≤10 km 30>10 km 28

198 georeferenced · 109 without coordinates

Open the mapobservation + sensor307

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 17 without coordinates

Open the institutions mapphysical evidence19

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	4
New Haven, US	1
Auckland, NZ	1

3 institutions · 6 of 19 vouchered records shown · 13 without an institution code

09Environmental DNA21 detections

Where the DNA of Aloa lactinea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 17.1–28.7

Seasonal swing summer↔winter19.9 °C

Max temp (day)26.2 °C 21.1–31.8

Min temp (night)18.4 °C 10.4–23.7

Precipitation378 mm/mo 174–448

Air humidity63.4 % 59.3–64.0

Moisture balance204 mm/mo 31.1–300

Vapour deficit1,053 Pa 706–1,598

Wind speed1.20 m/s 0.9–2.90

Cloud cover22.3 % 16.4–24.3

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)