Alnus incana
(L.) Moench · speciesAt a glance
Occurrence records225 887
Data sources13
Biological traits130
DNA specimens69
eDNA detections51
Sources13 archives
Databases and archives Alnus incana's data was compiled from.
WikipediaWikimedia Foundation15 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility225 887 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI51 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics69 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources130 traits
Chemical compositionNPASS29 compounds
Occurrence & distributionGBIF225 887 records
Environmental DNA1 datasets · 9 countries51 detections
DNA & barcodingBOLD · NCBI69 specimens
Genome at a glanceCCDB · GoaT · NCBI636 Mbp
01Narrative
Alnus incana, the grey alder or speckled alder, is a species of tree in the birch family, with a wide range across the cooler parts of the Northern Hemisphere.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology13
Leaf mass91.47 mg
Leaf size3 549 mm²
⚠ sources differ — TRY: 3 549 mm² · LEDA: 2 723 mm² · GIFT: 2 723 mm²
Plant height8.53 m
⚠ sources differ — GIFT: 8.53 m · LEDA: 14 m · USDA: 7.62 m · TRY: 10.06 m
Plant height generative14 m
Plant height max24 m
Plant height min3 m
Seed length3 mm
Seed mass0.73 mg
⚠ sources differ — TRY: 0.73 mg · LEDA: 0.55 mg · GIFT: 0.765 mg
Seed mass max3.5 mg
Seed mass min0.32 mg
Seed volume0.79 mm³
Seed volume max0.79 mm³
Seed volume min0.79 mm³
Life cycle & reproduction34
Bloom periodSpring
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewater
⚠ sources differ — LEDA: nautochor · GIFT: anemochorous
Flower conspicuousNo
Flowering endApr
Flowering startMar
Fruit seed period beginSpring
Fruit seed period endSummer
Growth rate USDARapid
Life formtree
Life spanperennial
⚠ sources differ — TRY: perennial · LEDA: poly-annuals < 5 years (short-lived perennials) · GIFT: perennial
Lifespan categoryShort
Lifespan years50 years
Pollination modeabiotic
Pollination syndromewind
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Reproduction asexualabsent
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateSlow
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment28
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureCoarse
Fruit colourbrown
Fruit fleshinessdry
Fruit typeachene
Growth formtree
Growth form USDAThicket Forming
Habitat GIFTforest,forestedges,hills,mountains,parks
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typeectomycorrhizal
Root depth min24 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry28
Anaerobic toleranceHigh
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementMedium
Fire resistantNo
Fire toleranceHigh
Frost free days min100 days
Leaf C:N ratio18.88 g/g
Leaf c487 mg/g
Leaf dry-matter content (LDMC)302 mg/g
⚠ sources differ — TRY: 302 mg/g · LEDA: 214 mg/g
Leaf n32.13 mg/g
Leaf p2.0 mg/g
Moisture useHigh
Nitrogen fixation levelMedium
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min32 in
Protein potentialLow
Salinity toleranceNone
Seed longevity index0.5
Shade toleranceMedium
Soil pH max7 pH
Soil pH min5 pH
Specific leaf area (SLA)18.22 mm²/mg
⚠ sources differ — TRY: 18.22 mm²/mg · LEDA: 18.33 mm²/mg · GIFT: 20.52 mm²/mg
Temperature min-33 °F
Wood density393 mg/cm³
Uses & economy16
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound1 084 250 per lb
ToxicityNone
Veneer productNo
Other traits9
Diaspore typegenerative dispersule
Fall conspicuousNo
Fruit seed abundanceLow
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr4.57 m
Planting density max1 200 per acre
Planting density min300 per acre
Seeds per fruit>1000
03Chemical composition29 compounds
Compounds documented for Alnus incana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Simple coumarins22
Flavonols3
Menthane monoterpenoids1
Lupane triterpenoids1
Pyranocoumarins $ Simple coumarins1
Documented compounds29 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3S)-3-ethenyl-9-methyl-3-(4-methylpent-3-enyl)-2H-furo[3,2-c]chromen-4-one | present | NPASS | |
| (9-Acetyloxy-1-methyl-6-oxo-[1]benzofuro[3,2-c]chromen-8-yl) acetate | present | NPASS | |
| 4-(10-Hydroxy-7-hydroperoxy-5,6E-dehydro-6,7-dihydrogeranyloxy)-5-methylcoumarin | present | NPASS | |
| 4-(10-Hydroxygeranyloxy)-5-methylcoumarin | present | NPASS | |
| 4-(10-Hydroxyneryloxy)-5-methylcoumarin | present | NPASS | |
| 4-[(2E,4R)-4-hydroxy-3,7-dimethylocta-2,6-dienoxy]-5-methylchromen-2-one | present | NPASS | |
| 4-[(2E,4R)-4-hydroxy-3-(hydroxymethyl)-7-methylocta-2,6-dienoxy]-5-methylchromen-2-one | present | NPASS | |
| 4-[(2E,4R,5E)-7-hydroperoxy-4-hydroxy-3,7-dimethylocta-2,5-dienoxy]-5-methylchromen-2-one | present | NPASS | |
| 4-[(2E,4S,6S)-6-hydroperoxy-4-hydroxy-3,7-dimethylocta-2,7-dienoxy]-5-methylchromen-2-one | present | NPASS | |
| 4-[(2Z,5R)-5-hydroxy-3-(hydroxymethyl)-7-methylocta-2,6-dienoxy]-5-methylchromen-2-one | present | NPASS |
05DNA & barcoding69 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alnus incana has left across the world's sequence archives.
At a glance
DNA specimens69
Marker genes7
GenBank sequences10
eDNA detections51
Countries11
The DNA barcodea real sequence read deposited for this species
ATGCGATACTTGGTGTGAATTGCAGAATCCCGCGAATCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCACCTGGCCGAGGGCACGT …
Alnus incana isolate L69 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK4★rbcL4★rbcLa★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Alnus incana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size635 700 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Alnus incana0.64 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records28–562n range28median28mode32records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2830×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · nw-europe-fl +8
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Mičieta K., 1982: Zytotaxonomischer Beitrag zur Flora des Javorníky-Gebirges II. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 55-61.
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1771
CCDB · fl-europaea — Eklundh-Ehrenburg,
CCDB · poland — Skali?ska M., Jankun A., Wcis?o H. et al. 1976. Further studies in chromosome numbers of Polish Angiosperms. Eleventh contribution. Acta Biol. Cracov. Ser. Bot. 19, 107-148.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1985. Kariologicheskaja kharakteristika nekotorykh vidov poleznykh rastenij flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 6: 3–8.
CCDB · ipcn-api-dl — Mikcieta, K. 1982. Zytotaxonomischer Beitrag zur Flora des Javornaiky-Gebirges II. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 29: 55–61.
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl — Parfenov, V. I. & S. A. Dmitrieva. 1988. Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika. Zapov. Belorussii Issl. 12: 3–8.
CCDB · ipcn-api-dl — Skalinska, M., H. JANKUN, H. Wcislo & e. al. 1976. Further studies in chromosome numbers of Polish angiosperms. XI. Acta Biol. Cracov., Ser. Bot. 19: 107–148.
CCDB · ipcn-api-dl — Borgen, L. & R. Elven. 1983. Chromosome numbers of flowering plants from northern Norway and Svalbard. Nord. J. Bot. 3: 301–306.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: IOPB chromosome number reports LXXVI. Taxon 31: 583–587.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-northern-plants — Eklundh-Ehrenberg 1946.
CCDB · eflora
CCDB · book-fedorov — Wetzel 1928, 1929
CCDB · book-fedorov — Woodworth 1929a, 1931
CCDB · book-fedorov — Jaretzky 1930
CCDB · book-fedorov — Li:ive A. 1954b
CCDB · book-fedorov — Woodworth 1929b 1930a, 1931 nan
CCDB · book-fedorov — Love A. 1954b
CCDB · book-fedorov — Gram et al. 1941
CCDB · book-fedorov — D. 1955)
CCDB · book-atlas-flowering-plants
CCDB · book-atlas-flowering-plants — Woodworth 1931
CCDB · book-atlas-flowering-plants — Gram et al. 1941
CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213
2n 562×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants
CCDB · book-fedorov — Poucques 1949b
CCDB · book-atlas-flowering-plants — Poucques 1949b
n 141×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Mehra, P. N. 1976. Cytology of Himalayan Hardwoods. Sree Saraswaty Press, Calcutta.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness98.8% BUSCO
08Occurrence & distribution
Record type225 887 records
Wild obs. + sensor215 342
Museum / vouchered8 702
Cultivated / captive711
Fossil24
Other1 108
Origin
Native37
Introduced5 209
Range
Area of Occupancy AOO333 520 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy67% within 1 km
≤100 m 54 693≤1 km 64 136≤10 km 57 675>10 km 1 194
177 698 georeferenced · 37 644 without coordinates
Open the mapobservation + sensor215 342
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy27% within 1 km
≤100 m 542≤1 km 1 128≤10 km 4 358>10 km 218
6 246 georeferenced · 2 456 without coordinates
Open the institutions mapphysical evidence8 702
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy12% within 1 km
≤100 m 3≤10 km 9>10 km 13
25 georeferenced · 686 without coordinates
Open the mapnot free-living711
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions127 of 233 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 554 |
| LDlocation not on record | 454 |
| Moscow State Universitylocation not on record | 318 |
| Salzburg, AT | 298 |
| Oulu, FI | 207 |
| Kuopio, FI | 172 |
| BIO-UNIPIlocation not on record | 154 |
| Olocation not on record | 130 |
| Turku, FI | 101 |
| Görlitz, DE | 99 |
| Karlsruhe, DE | 95 |
| Uppsala, SE | 92 |
| MeiseBGlocation not on record | 87 |
| Bern, CH | 84 |
| KMNlocation not on record | 83 |
| Moscow, US | 83 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 83 |
| SLU Artdatabankenlocation not on record | 80 |
| Jyväskylä, FI | 78 |
| Lausanne, CH | 74 |
| Mlocation not on record | 73 |
| Oskarshamn, SE | 72 |
| Green Bay, US | 70 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 61 |
| Vancouver, CA | 58 |
| Tartu, EE | 58 |
| Saint John, CA | 56 |
| Ann Arbor, US | 55 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 52 |
| Tallinn, EE | 47 |
| Adam Mickiewicz University in Poznańlocation not on record | 38 |
| BFLlocation not on record | 37 |
| Helsinki, FI | 36 |
| Provincia di Livornolocation not on record | 36 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 34 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 34 |
| Chongqing Museumlocation not on record | 32 |
| DBF-NHMDlocation not on record | 29 |
| Bozeman, US | 28 |
| Bergen, NO | 27 |
| Toronto, CA | 26 |
| Uniwersytet Warszawskilocation not on record | 26 |
| Pullman, US | 26 |
| Zürich, CH | 25 |
| Denver, US | 24 |
| Madison, US | 24 |
| Philadelphia, US | 22 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 22 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 21 |
| TROMlocation not on record | 20 |
| Bronx, US | 19 |
| Pocatello, US | 19 |
| Zürich, CH | 19 |
| IFR-DNFlocation not on record | 18 |
| Boise, US | 17 |
| Cheney, US | 16 |
| Dresden, DE | 16 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 15 |
| New Haven, US | 14 |
| MAlocation not on record | 13 |
| WTUlocation not on record | 13 |
| Kandalaksha State Nature Reservelocation not on record | 13 |
| Provo, US | 13 |
| Québec, CA | 13 |
| Missoula, US | 13 |
| PRClocation not on record | 13 |
| Philadelphia, US | 12 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 12 |
| Montréal, CA | 11 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 10 |
| BRNUlocation not on record | 10 |
| Philadelphia, US | 9 |
| Vitoria, ES | 9 |
| Millersville, US | 9 |
| Porrentruy, CH | 9 |
| Whitewater, US | 9 |
| Wlocation not on record | 9 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 8 |
| Tromso University Museumlocation not on record | 8 |
| CJBGlocation not on record | 8 |
| Hudson, US | 8 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 8 |
| Frankfurt am Main | 8 |
| ASUlocation not on record | 7 |
| Portland, US | 7 |
| Victoria, CA | 7 |
| Rotorua, NZ | 6 |
| San Angelo, US | 6 |
| Auckland, NZ | 6 |
| South Kensington, GB | 6 |
| Kingston, US | 6 |
| Mohonk Preservelocation not on record | 6 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 6 |
| Mount Pleasant, US | 5 |
| Forssa, FI | 5 |
| Trondheim, NO | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Rovaniemi, FI | 5 |
| NMBU:MINAlocation not on record | 5 |
| SZUlocation not on record | 5 |
| Logan, US | 5 |
| TUR-Alocation not on record | 5 |
| DOI/NPS, Greenbelt Parklocation not on record | 5 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| St. Paul, US | 4 |
| College Park, US | 4 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 4 |
| Orem, US | 4 |
| Stockholm, SE | 4 |
| Université Lavallocation not on record | 4 |
| Grand Junction, US | 4 |
| University of Wisconsinlocation not on record | 4 |
| Dekalb, US | 4 |
| Kew, GB | 4 |
| GJOlocation not on record | 4 |
| Saint Louis, US | 4 |
| GZUlocation not on record | 3 |
| Berlin, DE | 3 |
| Glarus, CH | 3 |
| McWane Science Centerlocation not on record | 3 |
| Ypsilanti, US | 3 |
| University of Stellenboschlocation not on record | 3 |
| Albuquerque, US | 3 |
| Fort Worth, US | 3 |
| FLADlocation not on record | 3 |
| WINlocation not on record | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Tampa, US | 3 |
| US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Flagstaff, US | 3 |
| Fulda, DE | 3 |
| Podgorica, ME | 3 |
| Chicago, US | 3 |
| Macomb, US | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| nbflocation not on record | 3 |
| Claremont, US | 3 |
| Yukon Universitylocation not on record | 3 |
| Edinburgh, GB | 3 |
| Mississippi State, US | 3 |
| Dhaka, BD | 3 |
| John May Museum of Natural Historylocation not on record | 2 |
| Tilburg, NL | 2 |
| Oregon State Universitylocation not on record | 2 |
| Chapel Hill, US | 2 |
| Durango, US | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Winterthur, CH | 2 |
| Davenport, US | 2 |
| Paris, FR | 2 |
| Göteborg, SE | 2 |
| BClocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Finnish Museum of Natural Historylocation not on record | 2 |
| Fargo, US | 2 |
| US | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| San Diego, US | 2 |
| University of New Hampshirelocation not on record | 2 |
| Oswego, US | 2 |
| CONCOLlocation not on record | 2 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 2 |
| Durham, US | 2 |
| Tacoma, US | 2 |
| IDElocation not on record | 2 |
| Montréal, CA | 2 |
| Columbia, US | 2 |
| CASlocation not on record | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Riverside, US | 2 |
| Cambridge, US | 1 |
| UNESP-FCAlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Sion, CH | 1 |
| Chadron, US | 1 |
| Cincinnati, US | 1 |
| Davis, US | 1 |
| Salamanca, ES | 1 |
| Wellington, NZ | 1 |
| Tampere, FI | 1 |
| Fredericksburg, US | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Weber State Universitylocation not on record | 1 |
| Pretoria, ZA | 1 |
| Porvoo, FI | 1 |
| BioFokuslocation not on record | 1 |
| University of Tennessee at Chattanoogalocation not on record | 1 |
| AUAlocation not on record | 1 |
| Frauenfeld, CH | 1 |
| Caldwell, US | 1 |
| Bend, US | 1 |
| GAlocation not on record | 1 |
| SDFlocation not on record | 1 |
| Salvador, BR | 1 |
| PrivatHerblocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| STNFlocation not on record | 1 |
| Granada, ES | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Fairfax, US | 1 |
| Beijing, CN | 1 |
| Smithsonian Institutionlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| KR | 1 |
| VALElocation not on record | 1 |
| San Jose, US | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Catholic University of Pekinglocation not on record | 1 |
| College of the Atlantic, Museumlocation not on record | 1 |
| University of Lethbridgelocation not on record | 1 |
| Brock University (BU)location not on record | 1 |
| University of Wisconsinlocation not on record | 1 |
| Entomological Society of Latvialocation not on record | 1 |
| Acadia Universitylocation not on record | 1 |
| Barcelona, ES | 1 |
| Bloomington, US | 1 |
| Walla Walla, US | 1 |
| BSBIlocation not on record | 1 |
| Chicago, US | 1 |
| Hamilton, US | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Hope Collegelocation not on record | 1 |
| HJAEFlocation not on record | 1 |
| FLASlocation not on record | 1 |
| University of Alberta Museumslocation not on record | 1 |
| PHlocation not on record | 1 |
| EL PASO, US | 1 |
| Dover, US | 1 |
| Bourges, FR | 1 |
233 institutions · 8 261 of 8 702 vouchered records shown · 340 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA51 detections
Where the DNA of Alnus incana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found51
Studies independent surveys1
Countries9
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 51 detections have coordinates
Open the map9 countries0
Northern temperate mixedwood standManaged boreal mixedwood standin planted wood
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.5 °C 8.10–16.7
Seasonal swing summer↔winter23.0 °C
Max temp (day)15.1 °C 10.4–22.0
Min temp (night)8.20 °C 3.70–12.9
Precipitation79.6 mm/mo 64.1–112
Air humidity60.8 % 56.3–64.9
Moisture balance-9.90 mm/mo -45.7–39.9
Vapour deficit552 Pa 422–805
Wind speed3.60 m/s 2.40–5.80
Cloud cover42.2 % 36.7–64.4
CHELSA 1981–2010, ~9 km grid, at location & month of 39 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.