Alnetoidia alneti

(Dahlbom, 1850) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Alnetoidia

At a glance

Occurrence records1 306

Data sources5

Biological traits2

DNA specimens270

eDNA detections420

Sources5 archives

Databases and archives Alnetoidia alneti's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 306 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI420 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics270 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 306 records

Environmental DNA4 datasets · 9 countries420 detections

DNA & barcodingBOLD270 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding270 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alnetoidia alneti has left across the world's sequence archives.

At a glance

DNA specimens270

BINs4

Marker genes1

eDNA detections420

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus267 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

41Gmostly conserved

57Tvariable

101Cmostly conserved

284Avariable

291Tmostly conserved

344Tvariable

509Amostly conserved

548Gmostly conserved

626Amostly conserved

CAATATATTTTATTTTTGGGATTTGAGCAGGAATAGTGGGGATAATATTGAGTATATTAATTCGAGTAGAATTAGCTCAACCAGGGGCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.70%

Haplotypes37

BINs4

Most divergent pair6.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hauptidia stellatasame family15.0%Erythroneura azasame family15.3%Forcipata acclinasame family16.2%Forcipata ipssame family16.5%Forcipata citrinellasame family17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 306 records

Wild obs. + sensor422

Museum / vouchered819

Cultivated / captive3

Other62

Range

Area of Occupancy AOO2 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 254≤1 km 96≤10 km 16>10 km 1

367 georeferenced · 55 without coordinates

Open the mapobservation + sensor422

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 635≤1 km 41≤10 km 45>10 km 1

722 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence819

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo universitario di Scienze della Terra di Romalocation not on record	59
NHMOlocation not on record	35
Metsähallituslocation not on record	23
SLU Artdatabankenlocation not on record	21
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	17
Philadelphia, US	15
neflocation not on record	6
Helsinki, FI	3
BioFokuslocation not on record	3
SGAV-and-NHMDlocation not on record	2
Tromsø, NO	1
Nova Scotia Museum of Natural Historylocation not on record	1
Washington, US	1

13 institutions · 187 of 819 vouchered records shown · 632 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA420 detections

Where the DNA of Alnetoidia alneti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found420

Studies independent surveys4

Countries9

Verifiable raw sequence linked221

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 420 detections have coordinates

Open the map9 countries0

Urban1. Forest & Woodland|1.4. Temperate ForestForest edge (suburban)1. Forest & Woodland | 1.4. Temperate Forest14. Artificial - Terrestrial | 14.5 Urban Ar…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.7 °C 11.0–17.7

Seasonal swing summer↔winter17.1 °C

Max temp (day)19.1 °C 13.2–21.8

Min temp (night)11.1 °C 8.40–13.8

Precipitation71.1 mm/mo 54.2–103

Air humidity61.0 % 58.0–64.3

Moisture balance-40.3 mm/mo -66.1–14.6

Vapour deficit686 Pa 504–800

Wind speed3.60 m/s 2.40–5.00

Cloud cover44.8 % 38.6–52.5

CHELSA 1981–2010, ~9 km grid, at location & month of 419 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alnetoidia alneti

At a glance

Sources5 archives

Diet & foraging2

At a glance

Record type1 306 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 13 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 306 records