Alloxysta victrix

(Westwood, 1833) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Figitidae/Alloxysta

At a glance

Occurrence records634

Data sources6

Biological traits0

DNA specimens215

eDNA detections119

Sources6 archives

Databases and archives Alloxysta victrix's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility634 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI119 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics215 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF634 records

Environmental DNA4 datasets · 9 countries119 detections

DNA & barcodingBOLD215 specimens

01Narrative

Alloxysta victrix is een vliesvleugelig insect uit de familie van de Figitidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1833 door Westwood.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding215 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alloxysta victrix has left across the world's sequence archives.

At a glance

DNA specimens215

BINs24

Marker genes3

eDNA detections119

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus198 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

1Amostly conserved

30Amostly conserved

33Gmostly conserved

36Gmostly conserved

39Cvariable

42Gmostly conserved

54Gvariable

57Amostly conserved

72Amostly conserved

73Tmostly conserved

78Gmostly conserved

79Amostly conserved

81Cvariable

84Tmostly conserved

90Gmostly conserved

96Tmostly conserved

99Amostly conserved

114Tmostly conserved

132Tmostly conserved

165Amostly conserved

180Gmostly conserved

189Gvariable

210Amostly conserved

211Tmostly conserved

213Amostly conserved

216Amostly conserved

219Cmostly conserved

228Amostly conserved

234Cmostly conserved

237Avariable

249Tmostly conserved

252Amostly conserved

261Amostly conserved

262Tmostly conserved

267Gmostly conserved

270Cmostly conserved

273Avariable

279Amostly conserved

289Amostly conserved

297Amostly conserved

315Gmostly conserved

318Tmostly conserved

321Tvariable

327Avariable

339Cmostly conserved

342Cmostly conserved

345Amostly conserved

346Tvariable

351Tmostly conserved

357Tmostly conserved

363Tvariable

366Tmostly conserved

372Gmostly conserved

381Cvariable

411Amostly conserved

414Gmostly conserved

429Amostly conserved

465Gmostly conserved

513Tmostly conserved

519Amostly conserved

540Amostly conserved

541Tmostly conserved

546Amostly conserved

549Gmostly conserved

552Tmostly conserved

555Tmostly conserved

556Cmostly conserved

558Amostly conserved

561Tvariable

564Gmostly conserved

567Avariable

573Tmostly conserved

579Amostly conserved

588Tmostly conserved

595Tmostly conserved

603Tmostly conserved

615Cmostly conserved

618Tvariable

621Amostly conserved

624Avariable

627Cvariable

630Tmostly conserved

633Cmostly conserved

645Tvariable

651Tmostly conserved

ATATTATATTTTATTTTTGGTATTTGATCAGGGATGATCGGGTCTGCTTTAAGGATAATTATTCGAATAGAATTAGGGACCCCTTCTCAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 42 variants.

Diversity (π)5.2%

Haplotypes42

BINs24

Most divergent pair8.7%

N.AmericaOceaniaEuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Alloxysta tschekisame genus4.4%Alloxysta pusillasame genus8.7%Alloxysta basimaculasame genus9.8%Alloxysta chinensissame genus9.9%Alloxysta pleuralissame genus10.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS218S-5P

animal barcodefungal barcoderibosomal

08Occurrence & distribution

Record type634 records

Wild obs. + sensor194

Museum / vouchered440

Origin

Introduced62

Range

Area of Occupancy AOO948 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy37% within 1 km

≤100 m 25≤1 km 40≤10 km 111

176 georeferenced · 18 without coordinates

Open the mapobservation + sensor194

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy73% within 1 km

≤100 m 100≤1 km 69≤10 km 62

231 georeferenced · 209 without coordinates

Open the institutions mapphysical evidence440

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MZLUlocation not on record	113
MWLRlocation not on record	62
SLU Artdatabankenlocation not on record	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	14
Helsinki, FI	11
Eszterhazy Karoly University of Applied Scienceslocation not on record	10
Trondheim, NO	6
New Zealand Arthropod Collectionlocation not on record	6
Auckland, NZ	5
Gothenburg, SE	4
Chicago, US	4
Norwegian Institute for Nature Researchlocation not on record	3
WIlocation not on record	2
Natick, US	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Vancouver, CA	1
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
NTNU-VMlocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1

19 institutions · 263 of 440 vouchered records shown · 177 without an institution code

09Environmental DNA119 detections

Where the DNA of Alloxysta victrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found119

Studies independent surveys4

Countries9

Verifiable raw sequence linked6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 119 detections have coordinates

Open the map9 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…17. OtherTemperate mixed forest1. Forest & Woodland|1.4. Forest - TemperateRiparian Zone8. Desert | 8.1. Hot Desert

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 10.8–20.4

Seasonal swing summer↔winter26.1 °C

Max temp (day)20.2 °C 15.8–25.7

Min temp (night)11.5 °C 5.90–15.9

Precipitation74.1 mm/mo 29.8–120

Air humidity58.7 % 52.5–61.6

Moisture balance-48.6 mm/mo -91.4–25.0

Vapour deficit686 Pa 571–1,015

Wind speed3.30 m/s 2.10–4.40

Cloud cover40.1 % 33.3–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 117 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)