Allorhinocoris speciosus

Bliven, 1960 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Miridae/Allorhinocoris

At a glance

Occurrence records145

Data sources5

Biological traits0

DNA specimens3

eDNA detections3

Sources5 archives

Databases and archives Allorhinocoris speciosus's data was compiled from.

GBIFGlobal Biodiversity Information Facility145 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF145 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allorhinocoris speciosus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.61%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

316Tvariable

343Cvariable

406Cvariable

436Gvariable

457Cvariable

574Tvariable

CACTTTATATTTCATTTTTGGAATATGATCAGGAATATTAGGCACATCAATAAGATGAATCATCCGAATCGAACTAGGGATGCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Neolygus belfragiisame family11.4%Neolygus inconspicuussame family11.6%Neolygus fagisame family11.8%Neolygus communissame family11.9%Neolygus vitticollissame family12.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type145 records

Wild obs. + sensor8

Museum / vouchered137

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2>10 km 2

4 georeferenced · 4 without coordinates

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 137 records without

Open the institutions mapphysical evidence137

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
San Francisco, US	127
Washington, US	8

2 institutions · 135 of 137 vouchered records shown · 2 without an institution code

09Environmental DNA3 detections

Where the DNA of Allorhinocoris speciosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.2 °C 15.2–16.7

Seasonal swing summer↔winter17.0 °C

Max temp (day)22.8 °C 22.8–24.4

Min temp (night)8.20 °C 8.20–8.60

Precipitation31.2 mm/mo 26.1–31.2

Air humidity55.5 % 47.6–55.5

Moisture balance-119 mm/mo -131–-119

Vapour deficit776 Pa 776–1,006

Wind speed1.60 m/s 1.60–1.80

Cloud cover33.4 % 32.0–33.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)