Allopiophila vulgaris

(Fallén, 1820) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Piophilidae/Allopiophila

At a glance

Occurrence records311

Data sources6

Biological traits1

DNA specimens12

eDNA detections9

Sources6 archives

Databases and archives Allopiophila vulgaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility311 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF311 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD12 specimens

01Narrative

Piophila setosa is een vliegensoort uit de familie van de Piophilidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1917 door Melander and Spuler.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging1

Feeding guild (larval)necrophagous

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allopiophila vulgaris has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes1

eDNA detections9

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 75 variable positions, in barcode order

40Avariable

211Amostly conserved

266Tmostly conserved

283Gmostly conserved

307Amostly conserved

364Tmostly conserved

373Gmostly conserved

409Amostly conserved

412Amostly conserved

418Cvariable

433Avariable

484Tmostly conserved

547Tmostly conserved

559Amostly conserved

560Gmostly conserved

561Cmostly conserved

564Gmostly conserved

567Cmostly conserved

569Amostly conserved

570Tmostly conserved

571Tmostly conserved

573Cmostly conserved

574Amostly conserved

576Tmostly conserved

578Tmostly conserved

584Amostly conserved

585Cmostly conserved

587Gmostly conserved

588Amostly conserved

589Tmostly conserved

590Cmostly conserved

591Gmostly conserved

592Amostly conserved

593Amostly conserved

594Amostly conserved

595Tmostly conserved

596Tmostly conserved

597Tmostly conserved

598Amostly conserved

599Amostly conserved

600Amostly conserved

601Tmostly conserved

603Cmostly conserved

605Tmostly conserved

607Amostly conserved

609Tmostly conserved

610Cmostly conserved

613Tmostly conserved

614Gmostly conserved

615Amostly conserved

616Cmostly conserved

617Cmostly conserved

618Cmostly conserved

619Amostly conserved

620Gmostly conserved

624Gmostly conserved

633Amostly conserved

634Cmostly conserved

635Cmostly conserved

636Cmostly conserved

637Amostly conserved

638Amostly conserved

639Tmostly conserved

640Tmostly conserved

641Cmostly conserved

644Tmostly conserved

645Amostly conserved

646Cmostly conserved

647Cmostly conserved

649Amostly conserved

652Tmostly conserved

653Tmostly conserved

654Tmostly conserved

655Amostly conserved

658Tmostly conserved

AACATTATACTTTATGTTCGGAGCTTGAGCAGGAATAGTAGGTACTTCCCTAAGTATCTTAATCCGAGCAGAGCTAGGACATCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.6%

Haplotypes4

BIN1

Most divergent pair1.1%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Arctopiophila vulgarissame family4.0%Parapiophila kugluktuksame family6.3%Allopiophila lonchaeoidessame genus6.6%Allopiophila pectiniventrissame genus7.6%Amphipogon hyperboreussame family8.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type311 records

Wild obs. + sensor172

Museum / vouchered139

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 131≤1 km 18≤10 km 22

171 georeferenced · 1 without coordinates

Open the mapobservation + sensor172

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 99≤1 km 17≤10 km 8>10 km 4

128 georeferenced · 11 without coordinates

Open the institutions mapphysical evidence139

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	49
University of Tokyo, Department of Zoologylocation not on record	28
Metsähallituslocation not on record	6
Helsinki, FI	5
ZMAAlocation not on record	4
Copenhagen, DK	3
Rovaniemi, FI	2

7 institutions · 97 of 139 vouchered records shown · 42 without an institution code

09Environmental DNA9 detections

Where the DNA of Allopiophila vulgaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

flies inside Penair building

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.5 °C 9.20–21.7

Seasonal swing summer↔winter17.9 °C

Max temp (day)17.9 °C 10.0–25.8

Min temp (night)12.5 °C 8.40–16.6

Precipitation65.0 mm/mo 62.3–67.7

Air humidity66.8 % 58.6–74.9

Moisture balance-44.9 mm/mo -74.9–-14.8

Vapour deficit744 Pa 343–1,145

Wind speed3.90 m/s 2.50–5.30

Cloud cover47.5 % 36.2–58.8

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)