Allonemobius fasciatus

(De Geer, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Trigonidiidae/Allonemobius

At a glance

Occurrence records1 378

Data sources8

Biological traits0

DNA specimens42

eDNA detections23

Sources8 archives

Databases and archives Allonemobius fasciatus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 378 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics42 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 378 records

Environmental DNA1 datasets · 2 countries23 detections

DNA & barcodingBOLD42 specimens

01Narrative

Allonemobius fasciatus, commonly known as the striped ground cricket, is an omnivorous species of cricket that belongs to the subfamily Nemobiinae.Howard, D. J., and Waring, G. L. "Topographic Diversity, Zone Width, and the Strength of Reproductive Isolation in a Zone of Overlap and Hybridization." Evolution 45. (1991): 1120-1135. A. fasciatus is studied in depth in evolutionary biology because of the species ability to hybridize with another Allonemobius species, A. socius.Birge, L. M., Hughes, A. L., Marshall, J. L., and Howard, D. J. "Mating Behaviour Differences and the Cost of Mating in Allonemobius fasciatus and A. socius." J Insect Behav 23 (2010): 268-289.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding42 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allonemobius fasciatus has left across the world's sequence archives.

At a glance

DNA specimens42

BINs5

Marker genes1

eDNA detections23

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

10Tmostly conserved

13Tmostly conserved

22Amostly conserved

34Gmostly conserved

46Tmostly conserved

58Tmostly conserved

59Cmostly conserved

61Amostly conserved

64Tmostly conserved

70Cvariable

79Cvariable

88Tvariable

91Cmostly conserved

100Tmostly conserved

106Cvariable

118Cmostly conserved

121Cmostly conserved

154Cmostly conserved

166Gvariable

169Cmostly conserved

172Tmostly conserved

184Amostly conserved

187Cmostly conserved

205Tmostly conserved

211Gmostly conserved

235Cmostly conserved

238Avariable

247Tmostly conserved

259Tmostly conserved

262Gmostly conserved

289Tvariable

322Amostly conserved

346Tmostly conserved

352Cvariable

355Cmostly conserved

356Tmostly conserved

376Amostly conserved

379Cmostly conserved

385Tmostly conserved

386Tmostly conserved

388Amostly conserved

391Tmostly conserved

394Cmostly conserved

397Cmostly conserved

401Tmostly conserved

406Cmostly conserved

407Cvariable

415Avariable

421Cvariable

424Tmostly conserved

433Amostly conserved

442Tvariable

445Tmostly conserved

475Cmostly conserved

478Tmostly conserved

484Tmostly conserved

487Amostly conserved

490Tmostly conserved

499Tmostly conserved

500Tmostly conserved

505Tmostly conserved

508Gmostly conserved

511Amostly conserved

520Amostly conserved

523Tmostly conserved

529Cmostly conserved

532Cmostly conserved

535Tvariable

539Cmostly conserved

541Tvariable

553Tmostly conserved

556Tmostly conserved

565Tmostly conserved

568Tmostly conserved

574Cmostly conserved

580Tmostly conserved

601Cvariable

607Amostly conserved

619Tvariable

631Amostly conserved

634Cmostly conserved

643Tmostly conserved

646Tmostly conserved

653Tmostly conserved

658Cmostly conserved

AACTTTATATTTTATTTTTGGAGCATGAGCTGGGATAGTAGGAACTTCTCTTAGAATTCTAATTCGAACCGAACTTGGCCAACCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes25

BINs5

Most divergent pair9.6%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allonemobius griseussame genus5.9%Allonemobius allardisame genus7.4%Allonemobius walkerisame genus8.1%Faculta inaequalissame order16.9%Haematopota glennisame order17.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 378 records

Wild obs. + sensor309

Museum / vouchered1 069

Origin

Native4

Range

Area of Occupancy AOO2 124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 173≤1 km 35≤10 km 7>10 km 42

257 georeferenced · 52 without coordinates

Open the mapobservation + sensor309

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy21% within 1 km

≤100 m 11≤1 km 88≤10 km 296>10 km 84

479 georeferenced · 590 without coordinates

Open the institutions mapphysical evidence1 069

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	306
University of Guelphlocation not on record	251
	112
Toronto, CA	103
Wuzhou, CN	89
Provo, US	78
Cleveland Museum of Natural History, OH (CLEV)location not on record	38
Saint John, CA	27
Vancouver, CA	21
University of Alabamalocation not on record	12
University of Guelph, Centre for Biodiversity Genomicslocation not on record	9
University of Central Floridalocation not on record	6
Royal Saskatchewan Museumlocation not on record	3
CUlocation not on record	2
New Haven, US	1
Universidad Católica de Manizaleslocation not on record	1
University Park, US	1

17 institutions · 1 060 of 1 069 vouchered records shown · 9 without an institution code

09Environmental DNA23 detections

Where the DNA of Allonemobius fasciatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map2 countries0

14. Artificial - Terrestrial | 14.2 Pasturel…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.4 °C 23.9–25.7

Seasonal swing summer↔winter11.2 °C

Max temp (day)30.7 °C 28.1–31.2

Min temp (night)20.5 °C 19.7–20.5

Precipitation76.5 mm/mo 70.0–112

Air humidity58.2 % 56.9–59.5

Moisture balance-101 mm/mo -106–-52.8

Vapour deficit1,348 Pa 1,202–1,413

Wind speed2.70 m/s 2.60–3.70

Cloud cover30.0 % 29.0–37.7

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allonemobius fasciatus

At a glance

Sources8 archives

At a glance

Record type1 378 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 378 records