Allomalia quadrivirgata

(A.Costa, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Brentidae/Allomalia

At a glance

Occurrence records19

Data sources5

Biological traits0

DNA specimens8

eDNA detections7

Sources5 archives

Databases and archives Allomalia quadrivirgata's data was compiled from.

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 3 countries7 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allomalia quadrivirgata has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections7

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.75%

Haplotypes2

BIN1

Most divergent pair1.1%

Where individuals differ — all 12 variable positions, in barcode order

40Avariable

61Amostly conserved

73Avariable

79Gmostly conserved

88Gmostly conserved

181Gmostly conserved

274Cmostly conserved

277Amostly conserved

316Gvariable

322Tmostly conserved

490Cmostly conserved

547Cvariable

AACTTTATATTTTATTTTTGGATTTTGATCAGGAATAGTAGGAACTTCCCTTAGTCTTTTAATTCGTTTAGAACTAGGGAATCCTGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Chionodes imbersame order15.3%Ballantiophora gibbiferatasame order15.5%Xanthorhoe aravensissame order15.8%Vietteia terstrigellasame order15.8%Prorophora mongolicasame order16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type19 records

Wild obs. + sensor5

Museum / vouchered14

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced · 3 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy57% within 1 km

≤100 m 2≤1 km 2≤10 km 3

7 georeferenced · 7 without coordinates

Open the institutions mapphysical evidence14

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	4
Paris, FR	3

2 institutions · 7 of 14 vouchered records shown · 7 without an institution code

09Environmental DNA7 detections

Where the DNA of Allomalia quadrivirgata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.7–18.0

Seasonal swing summer↔winter15.4 °C

Max temp (day)20.2 °C 16.7–20.8

Min temp (night)12.2 °C 10.0–15.4

Precipitation57.5 mm/mo 35.7–74.7

Air humidity59.5 % 56.2–63.0

Moisture balance-32.5 mm/mo -107–-0.4

Vapour deficit781 Pa 646–865

Wind speed2.80 m/s 2.30–3.70

Cloud cover38.9 % 35.0–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)