Allohelea johannseni

(Wirth, 1953) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Ceratopogonidae/Allohelea

At a glance

Occurrence records7

Data sources7

Biological traits0

DNA specimens14

eDNA detections13

Sources7 archives

Databases and archives Allohelea johannseni's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF7 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

Allohelea johannseni is a species of predaceous midge in the family Ceratopogonidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allohelea johannseni has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

19Cmostly conserved

22Amostly conserved

46Tmostly conserved

49Tmostly conserved

79Amostly conserved

88Amostly conserved

127Tmostly conserved

166Gmostly conserved

178Tmostly conserved

181Gmostly conserved

205Gmostly conserved

217Amostly conserved

241Amostly conserved

271Cmostly conserved

328Avariable

373Gmostly conserved

385Tvariable

400Tmostly conserved

406Tmostly conserved

433Avariable

436Amostly conserved

478Gmostly conserved

541Tmostly conserved

562Gvariable

565Amostly conserved

628Amostly conserved

646Cmostly conserved

AACTTTATACTTTATTTTCGGAGCTTGAGCTGGTATAGTTGGTACTTCTCTAAGAATTTTAATTCGAGCAGAATTAGGACATCCTGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes8

BIN1

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Oxysarcodexia cingarussame order12.9%Sarcophaga peregrinasame order12.9%Souzalopesiella facialissame order12.9%Sarcophaga villisternasame order13.4%Nemorimyza posticatasame order13.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor1

Museum / vouchered6

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the institutions mapphysical evidence6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
Wuzhou, CN	1
Washington, US	1
Lake Placid, US	1
Centre for Biodiversity Genomicslocation not on record	1

5 institutions · 5 of 6 vouchered records shown · 1 without an institution code

09Environmental DNA13 detections

Where the DNA of Allohelea johannseni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Forest1. Forest & Woodland|1.4. Temperate ForestGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.2 °C 17.3–19.2

Seasonal swing summer↔winter16.8 °C

Max temp (day)23.7 °C 21.7–23.7

Min temp (night)15.4 °C 15.0–16.3

Precipitation121 mm/mo 84.7–121

Air humidity59.1 % 58.1–60.3

Moisture balance-8.50 mm/mo -69.3–-8.50

Vapour deficit907 Pa 818–907

Wind speed2.50 m/s 2.50–4.00

Cloud cover37.0 % 37.0–41.6

CHELSA 1981–2010, ~9 km grid, at location & month of 13 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)