Allognosta obscuriventris

(Loew, 1863) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Stratiomyidae/Allognosta

At a glance

Occurrence records30

Data sources7

Biological traits0

DNA specimens10

eDNA detections10

Sources7 archives

Databases and archives Allognosta obscuriventris's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility30 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF30 records

Environmental DNA1 datasets · 1 countries10 detections

DNA & barcodingBOLD10 specimens

01Narrative

Allognosta obscuriventris is a species of soldier fly in the family Stratiomyidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allognosta obscuriventris has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes1

eDNA detections10

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

4Avariable

50Cmostly conserved

85Cvariable

100Amostly conserved

160Amostly conserved

271Cmostly conserved

310Avariable

325Cvariable

343Amostly conserved

373Gmostly conserved

412Avariable

484Avariable

499Cvariable

532Tmostly conserved

556Tmostly conserved

562Amostly conserved

604Tvariable

625Tvariable

AACATTATATTTTATTTTTGGTGCTTGAGCTGGAATAGTAGGAACATCTCTAAGAATTTTAATTCGAGCTGAATTAGGTCATCCCGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes8

BIN1

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allognosta vaganssame genus8.1%Haematostoma austenisame order10.8%Anopheles vanderwulpisame order11.1%Hydrotaea scambussame order11.1%Stypommisa pequeniensissame order11.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type30 records

Wild obs. + sensor9

Museum / vouchered21

Origin

Native2

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 6≤1 km 1≤10 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelphlocation not on record	3
University Park, US	3
McGill University, Lyman Entomological Museumlocation not on record	2
Los Angeles, US	2
Biodiversity Institute of Ontariolocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
CUlocation not on record	1

7 institutions · 13 of 21 vouchered records shown · 8 without an institution code

09Environmental DNA10 detections

Where the DNA of Allognosta obscuriventris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map1 country0

GrasslandBogTemperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 8.90–13.2

Seasonal swing summer↔winter26.9 °C

Max temp (day)16.4 °C 12.2–18.7

Min temp (night)7.80 °C 6.20–10.2

Precipitation94.1 mm/mo 89.8–100

Air humidity57.4 % 56.5–58.0

Moisture balance-23.7 mm/mo -26.2–-22.6

Vapour deficit616 Pa 485–665

Wind speed3.80 m/s 2.80–4.20

Cloud cover47.6 % 45.4–51.0

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)