Allognosta fuscitarsis

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Stratiomyidae/Allognosta

At a glance

Occurrence records229

Data sources7

Biological traits0

DNA specimens242

eDNA detections250

Sources7 archives

Databases and archives Allognosta fuscitarsis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility229 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI250 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics242 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF229 records

Environmental DNA1 datasets · 2 countries250 detections

DNA & barcodingBOLD242 specimens

01Narrative

Allognosta fuscitarsis is a species of soldier fly in the family Stratiomyidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding242 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allognosta fuscitarsis has left across the world's sequence archives.

At a glance

DNA specimens242

BINs1

Marker genes1

eDNA detections250

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P640 bp consensus238 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 18 variable positions, in barcode order

73Avariable

148Tvariable

151Avariable

190Avariable

191Cmostly conserved

259Amostly conserved

263Cvariable

313Cmostly conserved

340Tvariable

349Avariable

418Tvariable

436Tvariable

484Tvariable

586Tmostly conserved

589Cmostly conserved

601Tmostly conserved

613Amostly conserved

619Cmostly conserved

TTTTGGTGCTTGAGCAGGAATAGTTGGAACTTCTTTAAGAATTTTAATTCGCGCTGAATTAGGTCATCCAGGAGCATTAATTGGAAATGA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 51 variants.

Diversity (π)1.2%

Haplotypes51

BIN1

Most divergent pair3.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allognosta vaganssame genus10.2%Leptopteromyia americanasame order11.7%Picconia incurvasame order12.3%Orthocladius dorenussame order12.5%Tipula mediterraneasame order12.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type229 records

Wild obs. + sensor30

Museum / vouchered199

Origin

Native6

Range

Area of Occupancy AOO260 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 16≤1 km 6≤10 km 1>10 km 3

26 georeferenced · 4 without coordinates

Open the mapobservation + sensor30

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤1 km 1≤10 km 7>10 km 1

9 georeferenced · 190 without coordinates

Open the institutions mapphysical evidence199

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	50
Cornell University Insect Collectionlocation not on record	34
OSUClocation not on record	13
University Park, US	13
University of Guelphlocation not on record	8
Los Angeles, US	6
Cambridge, US	2
CUlocation not on record	1
Chicago, US	1
Biodiversity Institute of Ontariolocation not on record	1
St. Paul, US	1

11 institutions · 130 of 199 vouchered records shown · 69 without an institution code

09Environmental DNA250 detections

Where the DNA of Allognosta fuscitarsis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found250

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 250 detections have coordinates

Open the map2 countries0

Riparian ZoneTemperate mixed forestForest14. Artificial - Terrestrial | 14.2 Pasturel…WetlandGrassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.5 °C 17.6–24.4

Seasonal swing summer↔winter25.6 °C

Max temp (day)27.6 °C 21.9–28.6

Min temp (night)19.6 °C 13.2–20.2

Precipitation109 mm/mo 83.0–111

Air humidity59.8 % 56.8–60.8

Moisture balance-61.2 mm/mo -73.7–-37.7

Vapour deficit1,137 Pa 850–1,230

Wind speed3.90 m/s 2.80–4.00

Cloud cover38.2 % 37.7–43.4

CHELSA 1981–2010, ~9 km grid, at location & month of 250 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)