Alloeorhynchus flavipes

(Fieber, 1836) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Nabidae/Alloeorhynchus

At a glance

Occurrence records123

Data sources4

Biological traits0

DNA specimens6

eDNA detections0

Sources4 archives

Databases and archives Alloeorhynchus flavipes's data was compiled from.

GBIFGlobal Biodiversity Information Facility123 records↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page2 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF123 records

DNA & barcodingBOLD6 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alloeorhynchus flavipes has left across the world's sequence archives.

At a glance

DNA specimens6

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.10%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

478Cvariable

CACATTATACTTTTTATTTGGGATATGATCAGGAATAGTAGGAACATCATTAAGATGATTAATCCGAATTGAACTAGGACAACCGGGGTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Buenoa confusasame order16.7%Himacerus mirmicoidessame family17.3%Himacerus nodipessame family17.5%Notonecta undulatasame order17.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type123 records

Wild obs. + sensor112

Museum / vouchered8

Other3

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 45≤1 km 21≤10 km 30>10 km 2

98 georeferenced · 14 without coordinates

Open the mapobservation + sensor112

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 1

2 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Ilia State Universitylocation not on record	2

1 institutions · 2 of 8 vouchered records shown · 6 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)