Alloeocomatella pectinifera

(AH Clark, 1911) · species

image placeholder — illustration coming later

Animalia/Echinodermata/Crinoidea/Comatulida/Comatulidae/Alloeocomatella

At a glance

Occurrence records100

Data sources8

Biological traits4

DNA specimens6

eDNA detections6

Sources8 archives

Databases and archives Alloeocomatella pectinifera's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility57 records↗

OBISOcean Biodiversity Information System43 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS100 records

Environmental DNA1 datasets · 2 countries6 detections

DNA & barcodingBOLD6 specimens

01Narrative

Alloeocomatella pectinifera is een haarster uit de familie Comatulidae. De wetenschappelijke naam van de soort werd in 1911 gepubliceerd door Austin Hobart Clark.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max106 m

Depth min3 m

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alloeocomatella pectinifera has left across the world's sequence archives.

At a glance

DNA specimens6

BINs4

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P920 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 69 variable positions, in barcode order

9Avariable

45Tmostly conserved

54Cvariable

66Amostly conserved

129Amostly conserved

130Tmostly conserved

141Amostly conserved

151Tmostly conserved

159Tvariable

162Tmostly conserved

174Tmostly conserved

180Tvariable

205Cmostly conserved

208Tmostly conserved

210Avariable

216Avariable

231Avariable

236Gmostly conserved

246Tmostly conserved

258Tmostly conserved

276Amostly conserved

277Amostly conserved

279Amostly conserved

297Tmostly conserved

336Amostly conserved

348Amostly conserved

351Tvariable

363Avariable

366Cvariable

402Gmostly conserved

417Tvariable

438Amostly conserved

489Amostly conserved

498Tmostly conserved

505Cmostly conserved

507Avariable

519Tvariable

522Tmostly conserved

528Tmostly conserved

543Tmostly conserved

549Avariable

552Chighly variable

600Tmostly conserved

603Gmostly conserved

619Tmostly conserved

657Tmostly conserved

714Avariable

720Gvariable

729Cvariable

732Tvariable

733Cvariable

735Amostly conserved

738Tmostly conserved

744Tmostly conserved

747Tmostly conserved

750Tmostly conserved

780Tmostly conserved

783Tmostly conserved

795Avariable

804Amostly conserved

819Tvariable

840Tmostly conserved

843Amostly conserved

852Cvariable

858Tmostly conserved

864Tmostly conserved

891Amostly conserved

903Avariable

918Amostly conserved

GCTCAACCAGGGTCTTTTTTAGGAGATGATCAAATATATAAAGTTATTGTGACCTCTCATGCTTTAGTAATGATTTTTTTTATGGTTATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.3%

Haplotypes3

BINs4

Most divergent pair4.1%

OtherOceania

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type100 records

Wild obs. + sensor16

Museum / vouchered84

Range

Area of Occupancy AOO136 km²

Depth

0–200 m sunlit17

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 12.5 m · max 106 m · 17 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 7≤1 km 7≤10 km 1

15 georeferenced · 1 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤1 km 20≤10 km 4

24 georeferenced · 60 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	11
Brussels, BE	8
Paris, FR	5
Sydney, AU	4
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	4
Washington, US	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
RBINS-Scientific Heritagelocation not on record	3
CASlocation not on record	1

9 institutions · 43 of 84 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Alloeocomatella pectinifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.9 °C 22.7–25.9

Seasonal swing summer↔winter0.5 °C

Max temp (day)29.8 °C 28.7–29.8

Min temp (night)22.3 °C 16.4–22.3

Precipitation343 mm/mo 81.1–343

Air humidity69.6 % 48.6–69.6

Moisture balance205 mm/mo -73.1–205

Vapour deficit1,012 Pa 1,012–1,502

Wind speed0.6 m/s 0.6–3.30

Cloud cover57.4 % 26.0–57.4

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)