Allodynerus delphinalis

Gir., 1866 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Eumenidae/Allodynerus

At a glance

Occurrence records655

Data sources5

Biological traits0

DNA specimens7

eDNA detections1

Sources5 archives

Databases and archives Allodynerus delphinalis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility655 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF655 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD7 specimens

01Narrative

Allodynerus delphinalis is a species of wasp in the family Vespidae.Allodynerus at www.biolib.cz.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allodynerus delphinalis has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P557 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

1Tmostly conserved

2Amostly conserved

3Amostly conserved

4Gmostly conserved

6Amostly conserved

7Tmostly conserved

8Amostly conserved

17Amostly conserved

53Tmostly conserved

72Gmostly conserved

113Cvariable

128Cmostly conserved

155Tmostly conserved

182Cmostly conserved

221Amostly conserved

228Tmostly conserved

266Amostly conserved

290Cmostly conserved

335Tmostly conserved

401Tmostly conserved

515Amostly conserved

TAAGAATAATTATTCGACTAGAACTTATAACCCCAGGAAAATTAATTAACAATGATCAAATCTATAATACAGTTGTTACAGCCCATGCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes5

BIN1

Most divergent pair2.7%

EuropeAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allodynerus floricolasame genus14.5%Euodynerus curictensissame family16.0%Leptochilus regulussame family16.3%Euodynerus notatussame family16.3%Antepipona deflendasame family16.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type655 records

Wild obs. + sensor292

Museum / vouchered356

Other7

Origin

Native64

Range

Area of Occupancy AOO1 496 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy47% within 1 km

≤100 m 88≤1 km 20≤10 km 118>10 km 4

230 georeferenced · 62 without coordinates

Open the mapobservation + sensor292

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 58≤1 km 77≤10 km 147>10 km 4

286 georeferenced · 70 without coordinates

Open the institutions mapphysical evidence356

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	60
Provincia di Livornolocation not on record	58
Muzeum Górnośląskie w Bytomiulocation not on record	55
Zürich, CH	35
Musee d'Histoire Naturallelocation not on record	21
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	12
Philadelphia, US	12
Geneva, CH	8
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	8
Paro, BT	3
ZSMlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Tilburg, NL	3
Bern, CH	2
Ibaraki Universitylocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	1
FSCVlocation not on record	1
NMOKlocation not on record	1
CAFKlocation not on record	1

19 institutions · 289 of 356 vouchered records shown · 67 without an institution code

09Environmental DNA1 detections

Where the DNA of Allodynerus delphinalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)