Alloclavaria purpurea

(O.F.Müll.) Dentinger & D.J.McLaughlin · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Hymenochaetales/Rickenellaceae/Alloclavaria

At a glance

Occurrence records3 131

Data sources8

Biological traits0

DNA specimens7

eDNA detections9

Sources8 archives

Databases and archives Alloclavaria purpurea's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 131 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 131 records

Environmental DNA4 datasets · 3 countries9 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Alloclavaria purpurea is a coral fungus commonly known as the purple coral, or the purple fairy club. Formerly known as Clavaria purpurea, it has been moved to its own genus as a result of phylogenetic analysis.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Alloclavaria purpurea has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections9

Countries3

The DNA barcodea real sequence read deposited for this species

ITSOR676995.1 ↗587 bpCanada · 2022

ACGT

GATGCTGGCCTCCTTAACCAGAGGCATGTGCTCGCCCCGCTCATCCACTCAACCCCATGTGCACTCTTGAGATGTGGCCCTCCGTAATGG …

Alloclavaria purpurea voucher 58 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type3 131 records

Wild obs. + sensor2 719

Museum / vouchered412

Range

Area of Occupancy AOO9 068 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 1 656≤1 km 469≤10 km 232>10 km 125

2 482 georeferenced · 237 without coordinates

Open the mapobservation + sensor2 719

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 73≤1 km 116≤10 km 30>10 km 8

227 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence412

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	108
Olocation not on record	57
Oulu, FI	56
SLU Artdatabankenlocation not on record	41
TENN-Flocation not on record	32
Denver, US	15
Trondheim, NO	12
Vancouver, CA	4
KOMlocation not on record	4
Göteborg, SE	4
Chicago, US	4
Stockholm, SE	3
Turku, FI	3
Kuopio, FI	3
LDlocation not on record	2
Southeastern Louisiana University, Vertebrate Museumlocation not on record	2
Université de Montréal Biodiversity Centrelocation not on record	2
TROMlocation not on record	1
Toronto, CA	1
Tomioka, JP	1
Brisbane, AU	1
Metsähallituslocation not on record	1
Acadia Universitylocation not on record	1
St. Paul, US	1
Uppsala, SE	1
University of Oslo, Natural History Museumlocation not on record	1
WTUlocation not on record	1
Chiba, JP	1
Odawara, JP	1
nsnflocation not on record	1
Private Collection of Autumn Anglinlocation not on record	1
Personal Herbarium of Christin Sweariganlocation not on record	1

32 institutions · 367 of 412 vouchered records shown · 43 without an institution code

09Environmental DNA9 detections

Where the DNA of Alloclavaria purpurea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys4

Countries3

Verifiable raw sequence linked3

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.8 °C 7.80–17.2

Seasonal swing summer↔winter21.0 °C

Max temp (day)16.6 °C 9.60–23.8

Min temp (night)8.40 °C 5.90–10.5

Precipitation107 mm/mo 71.8–451

Air humidity60.3 % 48.1–63.3

Moisture balance25.4 mm/mo

Vapour deficit603 Pa 390–1,023

Wind speed2.80 m/s

Cloud cover44.2 % 23.5–53.5

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Alloclavaria purpurea

At a glance

Sources8 archives

At a glance

Record type3 131 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 131 records