Allocassine laurifolia

(Harv.) N.Robson · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Celastrales/Celastraceae/Allocassine

At a glance

Occurrence records86

Data sources6

Biological traits13

DNA specimens8

eDNA detections5

Sources6 archives

Databases and archives Allocassine laurifolia's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility86 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF86 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI8 specimens

01Narrative

Allocassine N. Robson é um género botânico pertencente à família Celastraceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max6 m

Plant height min1.5 m

Life cycle & reproduction2

Life formscrambling shrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberobligatory

Elevation max610 m

Elevation min25 m

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allocassine laurifolia has left across the world's sequence archives.

At a glance

DNA specimens8

Marker genes5

GenBank sequences4

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSDQ217500.1 ↗651 bp

ACGT

AAGGATCATTGTCGAAACCTGCAACGCAGAACGACCCGCGAATCGGTCTAAACTAATGCGGACGGCGGTCCTCAGGGCCCGTCGCCCCGA …

Allocassine laurifolia 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★ITS1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type86 records

Wild obs. + sensor23

Museum / vouchered63

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 18≤1 km 4≤10 km 1

23 georeferenced

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤1 km 3≤10 km 1

4 georeferenced · 59 without coordinates

Open the institutions mapphysical evidence63

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban, ZA	29
Pretoria, ZA	20
MeiseBGlocation not on record	4
University of Johannesburglocation not on record	2
Kew, GB	2
Bronx, US	1

6 institutions · 58 of 63 vouchered records shown · 5 without an institution code

09Environmental DNA5 detections

Where the DNA of Allocassine laurifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.4 °C 17.7–21.6

Seasonal swing summer↔winter8.80 °C

Max temp (day)24.1 °C 23.8–24.2

Min temp (night)14.6 °C 11.3–19.2

Precipitation67.8 mm/mo 41.4–96.0

Air humidity61.4 % 57.8–65.8

Moisture balance-70.5 mm/mo -108–-20.6

Vapour deficit850 Pa 763–989

Wind speed1.60 m/s 1.60–5.90

Cloud cover25.5 % 17.5–28.9

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)