Allocapnia vivipara

(Claassen, 1924) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Plecoptera/Capniidae/Allocapnia

At a glance

Occurrence records6 445

Data sources7

Biological traits0

DNA specimens29

eDNA detections28

Sources7 archives

Databases and archives Allocapnia vivipara's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 445 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI28 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics29 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 445 records

Environmental DNA1 datasets · 2 countries28 detections

DNA & barcodingBOLD29 specimens

01Narrative

Allocapnia vivipara, the short-wing snowfly, is a species of small winter stonefly in the family Capniidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding29 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allocapnia vivipara has left across the world's sequence archives.

At a glance

DNA specimens29

BINs2

Marker genes2

eDNA detections28

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus26 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

10Tmostly conserved

88Gmostly conserved

133Cmostly conserved

262Gmostly conserved

316Amostly conserved

343Cmostly conserved

358Tmostly conserved

361Tmostly conserved

367Cmostly conserved

373Amostly conserved

460Cmostly conserved

571Cmostly conserved

619Amostly conserved

634Tmostly conserved

646Cmostly conserved

AACTTTATATTTCATTTTTGGAGCCTGAGCAGGAATAGTCGGAACGTCTTTAAGTTTATTAATTCGAGCTGAACTAGGACAACCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes12

BINs2

Most divergent pair2.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allocapnia illinoensissame genus4.7%Allocapnia unzickerisame genus4.9%Allocapnia mysticasame genus5.0%Allocapnia wrayisame genus5.2%Allocapnia forbesisame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

08Occurrence & distribution

Record type6 445 records

Wild obs. + sensor332

Museum / vouchered6 113

Range

Area of Occupancy AOO7 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 261≤1 km 24≤10 km 3>10 km 3

291 georeferenced · 41 without coordinates

Open the mapobservation + sensor332

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy96% within 1 km

≤100 m 2 359≤1 km 3 395≤10 km 196>10 km 13

5 963 georeferenced · 150 without coordinates

Open the institutions mapphysical evidence6 113

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	4 945
Provo, US	399
Purdue Entomological Research Collectionlocation not on record	331
Wuzhou, CN	92
WKUClocation not on record	66
ISIClocation not on record	41
CNClocation not on record	36
RFKirchner-INHSlocation not on record	25
OSUClocation not on record	20
PNHClocation not on record	17
BYUClocation not on record	15
UKIClocation not on record	14
UMSPlocation not on record	13
SIUC-INHSlocation not on record	10
Philadelphia, US	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Cornell University Insect Collectionlocation not on record	4
BPSClocation not on record	3
OBS-INHSlocation not on record	2
US	2
Chicago, US	2
INHS Insect Collectionlocation not on record	1
Ann Arbor, US	1

23 institutions · 6 050 of 6 113 vouchered records shown · 63 without an institution code

09Environmental DNA28 detections

Where the DNA of Allocapnia vivipara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found28

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 28 detections have coordinates

Open the map2 countries0

Grassland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median2.90 °C -3.40–6.50

Seasonal swing summer↔winter25.6 °C

Max temp (day)8.40 °C 0.9–11.9

Min temp (night)-1.80 °C -8.00–1.80

Precipitation75.6 mm/mo 62.6–89.7

Air humidity57.4 % 55.6–59.8

Moisture balance22.9 mm/mo -12.3–31.4

Vapour deficit320 Pa 193–433

Wind speed4.80 m/s 3.60–5.00

Cloud cover47.3 % 43.6–54.9

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allocapnia vivipara

At a glance

Sources7 archives

At a glance

Record type6 445 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 445 records