Allobaccha eclara

(Curran, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Syrphidae/Allobaccha

At a glance

Occurrence records111

Data sources4

Biological traits0

DNA specimens7

eDNA detections9

Sources4 archives

Databases and archives Allobaccha eclara's data was compiled from.

GBIFGlobal Biodiversity Information Facility111 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF111 records

Environmental DNA1 datasets · 2 countries9 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allobaccha eclara has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections9

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.61%

Haplotypes1

BIN1

Where individuals differ — all 9 variable positions, in barcode order

78Tmostly conserved

304Gmostly conserved

420Cvariable

435Amostly conserved

449Cmostly conserved

461Amostly conserved

475Gmostly conserved

489Cmostly conserved

615Tvariable

ACATTATATTTCTTATTTGGTGCTTGAGCTGGAATAGTAGGTACATCTTTAAGAATTTTAATTCGTGCTGAACTTGGTCATCCAGGAGCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Allobaccha ichneumoneasame genus4.7%Allobaccha marginatasame genus5.3%Allobaccha bequaertisame genus5.4%Allobaccha brevissame genus6.0%Epistrophe crypticasame family9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type111 records

Wild obs. + sensor3

Museum / vouchered108

Range

Area of Occupancy AOO132 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 1≤1 km 1>10 km 1

3 georeferenced

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 7

7 georeferenced · 101 without coordinates

Open the institutions mapphysical evidence108

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
KwaZulu-Natal Museumlocation not on record	101

1 institutions · 101 of 108 vouchered records shown · 7 without an institution code

09Environmental DNA9 detections

Where the DNA of Allobaccha eclara was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map2 countries0

1. Forest & Woodland|1.5. Subtropical/Tropic…Sabie/Crocodile Thorn Thicket

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.9 °C 19.7–25.0

Seasonal swing summer↔winter8.70 °C

Max temp (day)28.2 °C 24.9–29.3

Min temp (night)20.0 °C 14.3–21.9

Precipitation77.8 mm/mo 37.2–90.2

Air humidity59.1 % 57.0–65.6

Moisture balance-62.4 mm/mo -66.5–-38.6

Vapour deficit1,037 Pa 944–1,236

Wind speed2.00 m/s 1.90–2.70

Cloud cover36.9 % 17.2–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)