Allium wallichii

Kunth · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Allium

At a glance

Occurrence records604

Data sources13

Biological traits15

DNA specimens14

eDNA detections14

Sources13 archives

Databases and archives Allium wallichii's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility604 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF604 records

Environmental DNA1 datasets · 2 countries14 detections

DNA & barcodingBOLD · NCBI14 specimens

Genome at a glanceCCDB · GoaT25.7 Gbp

01Narrative

Allium wallichii is a plant species native to India, Nepal, Sikkim, Bhutan, Myanmar, and parts of China (Guangxi, Guizhou, Hunan, Sichuan, Tibet, Xizang, Yunnan). It grows at elevations of 2300–4800 m.Flora of China v 24 p 175 Allium wallichii has elongate roots and clusters of narrow bulbs. Scapes are up to 110 cm tall, triangular in cross-section. Leaves are flat, up to 20 mm across, usually shorter than the scape. Flowers are white, pink, red, dark purple (sometimes almost black).Karl Sigismund Kunth. 1843. Enumeratio Plantarum Omnium Hucusque Cognitarum 4: 443.Zhu, Zheng Yin. 1991. Bulletin of Botanical Research. Harbin 11(1): 33., as Allium liangshanense

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Leaf width max500 mm

Leaf width min200 mm

Seed mass4.59 mg

Life cycle & reproduction2

Life formbulbous geophyte

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Climatetemperate

Climberself-supporting

Elevation max4 800 m

Elevation mean3 550 m

Elevation min2 300 m

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition8 compounds

Compounds documented for Allium wallichii across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Illudalane sesquiterpenoids1

Lactones1

Stigmastane steroids1

Humulane sesquiterpenoids $ Tetraketide meroterpenoids1

Sorbicilinoids1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(5S)-5-[(1S,2Z,4E)-1-hydroxyhexa-2,4-dienyl]oxolan-2-one	present	NPASS
Acremolin	present	NPASS
Acremostrictin	present	NPASS
Imperatorin	present	LOTUS
KXOHHVVQXCNKBM-QDOWTLGRSA-N	present	NPASS
Sitogluside	present	LOTUS
Xenovulene A	present	NPASS

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allium wallichii has left across the world's sequence archives.

At a glance

DNA specimens14

Marker genes4

GenBank sequences10

eDNA detections14

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPV331322.1 ↗639 bpIndia · 2018

ACGT

CCCTCTTCAAGAGATTGAGAACGTGTAGCATTACCCATCGAGAATATGCTAGTTTTGCAAGCGCACTTCTGCTTTCTAGATGGATGTCCT …

Allium wallichii voucher ABANERJEE64504A internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL8★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Allium wallichii carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size25 721 400 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

THIS GENOME Allium wallichii25.72 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 14 n = 7

Ploidy2× / 4× cytotypes

Chromosome records14–722n range16median14mode19records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 147×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 +2

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · ipcn-api-dl — Ohri, D. & K. Pistrick. 2001. Phenology and genome size variation in Allium L.---a tight correlation?. Pl. Biol. (Stuttgart) 3: 654–660.

CCDB · ipcn-api-dl — Huang, R. f., J. m. Xu & Y. Hong. 1995. A study on karyotypes and their evolutionary trends in Allium sect. Bromatorrhiza Ekberg (Liliaceae). Cathaya 7: 133–145.

CCDB · ipcn-api-dl — Hongguan. 2005. Origin of the Qinghai-Tibetan Plateau endemic Milula (Liliaceae): further insights from karyological comparisons with Allium. Caryologia 58(4): 320–331.

CCDB · book-ipcn73-74 — KUROSAWA, s. 1971. Cytological studies on some eastern Himalayan plants and their related species. The Flora of eastern Himalaya. Second report. pp. 355-364. Univ. Tokyo Press.

CCDB · book-indian_vol2 — Kuro~awa, S. l971b

CCDB · kew — Ohri D, Fritsch R, Hanelt P. (pers. comm. 1996).

2n 163×CCDB · book-indian_vol2 · CCDB · book-fedorov

CCDB · book-indian_vol2 — Mensinkai, S.W. 1939, 1940

CCDB · book-indian_vol2 — Kumar, V. & Chauhan, K.P.S.

CCDB · book-fedorov — Mensinkai 1939a, 1940

2n 283×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Ohri D, Fritsch R, Hanelt P. (pers. comm. 1996).

2n 323×CCDB · book-indian_vol2 · CCDB · book-fedorov

CCDB · book-indian_vol2 — Ved Brat, S. 1965a

CCDB · book-indian_vol2 — Datta, N. 194lc

CCDB · book-fedorov — Ved Brat 1965a

2n 482×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Sharma, A. K. 1970. Annual report, 1967-1968. Res. Bull. Univ. Calcutta Cytogenetics Lab. 2: 1–50.

CCDB · book-ipcn75-78 — Sharma 1970

2n 721×CCDB · book-indian_vol2

CCDB · book-indian_vol2 — Kumar, V. & Chauhan, K.P.S.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type604 records

Wild obs. + sensor64

Museum / vouchered451

Cultivated / captive66

Other23

Origin

Introduced58

Range

Area of Occupancy AOO848 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 25≤1 km 14≤10 km 2>10 km 3

44 georeferenced · 20 without coordinates

Open the mapobservation + sensor64

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 2≤10 km 12>10 km 10

24 georeferenced · 427 without coordinates

Open the institutions mapphysical evidence451

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 58

58 georeferenced · 8 without coordinates

Open the mapnot free-living66

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	157
Kunming, CN	80
Herbarium of the Department of Botany, University of Tokyolocation not on record	38
Chengdu, CN	28
Chengdu, CN	27
GMBAlocation not on record	17
Edinburgh, GB	13
Guangzhou, CN	13
CASlocation not on record	10
Kathmandu, NP	9
Changsha, CN	6
Guilin, CN	6
Yangling, CN	6
Natural History Museum, Tribhuvan Universitylocation not on record	6
Nanjing, CN	5
Kew, GB	4
Saint Louis, US	4
South Kensington, GB	3
Taipei, TW	3
Xining, CN	3
National Institute of Biological Resourceslocation not on record	2
THIMlocation not on record	1
Moscow State Universitylocation not on record	1
Hazara Universitylocation not on record	1
Wuhan, CN	1
Paris, FR	1
National Herbarium and Plant Laboratories, Nepallocation not on record	1
Zhengzhou, CN	1
Fort Worth, US	1

29 institutions · 448 of 451 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA14 detections

Where the DNA of Allium wallichii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 7.00–9.70

Seasonal swing summer↔winter26.1 °C

Max temp (day)12.3 °C 9.60–15.1

Min temp (night)3.00 °C 3.00–3.10

Precipitation430 mm/mo 97.0–763

Air humidity59.7 % 48.5–71.0

Moisture balance321 mm/mo -12.1–653

Vapour deficit542 Pa 314–770

Wind speed4.00 m/s 3.70–4.40

Cloud cover30.2 % 25.4–35.0

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)