Allium vineale
speciesAt a glance
Occurrence records174 709
Data sources10
Biological traits57
DNA specimens27
eDNA detections121
Sources10 archives
Databases and archives Allium vineale's data was compiled from.
GBIFGlobal Biodiversity Information Facility174 709 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI121 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics27 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources57 traits
Occurrence & distributionGBIF174 709 records
Environmental DNA2 datasets · 5 countries121 detections
DNA & barcodingBOLD · NCBI27 specimens
Genome at a glanceCCDB · GoaT22.1 Gbp
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology16
Fruit length3.25 mm
Leaf length150 mm
Leaf length max600 mm
Leaf length min150 mm
Leaf mass101 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 1 195 mm² · GIFT: 1 195 mm²
Leaf width2 mm
Leaf width max18 mm
Leaf width min2 mm
Plant height0.375 m
⚠ sources differ — GIFT: 0.375 m · AusTraits: 0.8 m · LEDA: 0.25 m · TRY: 0.501 m
Plant height generative0.5 m
Plant height max0.8 m
Plant height min0.3 m
Seed mass6.77 mg
⚠ sources differ — TRY: 6.77 mg · LEDA: 7.5 mg · GIFT: 7.39 mg
Seed mass max19 mg
Seed mass min1.14 mg
Life cycle & reproduction17
Deciduousnessdeciduous
⚠ sources differ — TRY: deciduous · GIFT: evergreen
Dehiscencedehiscent
Dispersal typeself
⚠ sources differ — LEDA: boleochor · GIFT: anemochorous
Flower colourgreen
Flower length max3.5 mm
Flower length min2.8 mm
Flowering endAug
Flowering startJun
Flowering timeyynnnnnnnnny
Life formbulbous geophyte
Life spanperennial
⚠ sources differ — TRY: perennial · AusTraits: perennial · LEDA: annuals · GIFT: perennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Reproduction asexualabsent
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max1 800 m
Elevation min0 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf formlinear
Leaf shapeterete
Mycorrhiza type0.00000000111
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)170 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)16.54 mm²/mg
⚠ sources differ — TRY: 16.54 mm²/mg · LEDA: 18.7 mm²/mg · GIFT: 18.7 mm²/mg
Other traits3
Diaspore typevegetative dispersule
Inflorescencecyme
Seeds per fruit11-100
05DNA & barcoding27 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allium vineale has left across the world's sequence archives.
At a glance
DNA specimens27
Marker genes6
GenBank sequences10
eDNA detections121
Countries6
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTCTTTGAATGCAAGTTGCGCACGAGGCCATTAGGTCGAGTGCACGTCTGTTTGGGCGTCATGTAAAGCGTCATTCCA …
Allium vineale voucher PLT.0327 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★trnL-F★ITS8★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Allium vineale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size22 093 020 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Allium vineale22.09 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records16–482n range32median32mode126records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3283×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · ita-fl · CCDB · slov-fl +13
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · ita-fl — TORNADORE N., MARCUCCI R. - 2005. Analisi cariologica e micromorfologica di alcuni taxa del Distretto Euganeo (Padova, NE Italia). Inform. Bot. Ital. , 37(1A): 56-57.
CCDB · ita-fl — MARCHI P., CAPINERI R., D'AMATO G. - 1974. Numeri cromosomici per la flora italiana:182-189.. Inform. Bot. Ital. , 6(3): 303-312.
CCDB · ita-fl — SCRUGLI A. - 1972. Numeri cromosomici per la flora italiana:124.. Inform. Bot. Ital. , 4(2): 128.
CCDB · slov-fl — Murín A., Svobodová Z., Májovský J. & Feráková V., 1999: Chromosome numbers of some species of the Slovak flora. - Thaiszia - J. Bot., Košice 9/1: 31-40.
CCDB · slov-fl — Májovský J. et al., 1976: Index of chromosome numbers of Slovakian flora (Part 5). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 25: 1-18.
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=4791
CCDB · poland — Skali?ska M., Ma?ecka J., Izmai?ow R. et al. 1974. Further studies in chromosome numbers of Polish Angiosperms. Tenth contribution. Acta Biol. Cracov. Ser. Bot. 17, 133-163.
CCDB · poland — Krawczyk J., Korna? A. and Joachimiak A. 1988. Giemsa C-banding karyotype analysis of wild Allium species from Poland. II. Karyotype structure and C-heterochromatin polymorphism in Allium vineale. Acta Biol. Cracov. Ser. Bot. 30, 51-62.
CCDB · ipcn-api-dl — Tzanoudakis, D. 1985. Chromosome studies in some species of Allium sect. Allium in Greece. Ann. Mus. Goulandris 7: 233–247.
CCDB · ipcn-api-dl — Pogosian, A. I. 1983. Chromosome numbers of some species of the Allium (Alliaceae) distributed in Armenia and Iran. Bot. Zhurn. 68 (5): 652–660. (In Russian).
CCDB · ipcn-api-dl — Speta, F. 1984. Uber Oberosterreichs wildwachsende Laucharten (Allium L., Alliaceae). Linzer Biol. Beitr. 16: 45–81.
CCDB · ipcn-api-dl — Wittmann, H. 1984. Beitrage zur Karyologie der Gattung Allium und zur Verbreitung der Arten im Bundesland Salzburg (Osterreich). Linzer Biol. Beitr. 16: 83–104.
CCDB · ipcn-api-dl — Özhatay, N. 1990. The genus Allium in European Turkey and around Istanbul. Ann. Mus. Goulandris 8: 115–128.
CCDB · ipcn-api-dl — Pogosian, A. I. 1991. Cytotaxonomical investigation of the Caucasian representatives of the subgenus Allium (Alliaceae). Fl. Rastitel'n. Rastitel'n. Resursy Armenii 13: 116–134.
CCDB · ipcn-api-dl — Wetschnig, W. 1992. Chromosomenzahlen Kärntner Gefässpflanzen (Teil 3): Karyologie und Verbreitung der Allium-Arten (Alliaceae) in Kárnten. Carinthia II 182: 497–533.
CCDB · ipcn-api-dl — Lovka, M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 21–23.
CCDB · ipcn-api-dl — Joachimiak, A., A. Kornas & J. Krawczyk. 1994. Alterations in chromosome morphology after sequentional aceto-orceine staining and C-banding. Acta Biol. Cracov., Ser. Bot. 36: 23–30, pls.2–3.
CCDB · ipcn-api-dl — De Sarker, D., M. A. T. Johnson, A. Reynolds & P. E. Brandham. 1997. Cytology of the highly polyploid disjunct species, Allium dregeanum (Alliaceae), and of some Eurasian relatives. Bot. J. Linn. Soc. 124: 361–373.
CCDB · ipcn-api-dl — Murín, A., Z. Svobodová, J. Májovský & V. Feráková. 1999. Chromosome numbers of some species of the Slovak flora. Thaiszia 9(1): 31–40.
CCDB · ipcn-api-dl — Marchi, P., R. Capineri & G. D'AMATO. 1974. Numeri cromosomici per la flora Italiana: 182-189. Inform. Bot. Ital. 6: 303–312.
CCDB · ipcn-api-dl — Murin, A. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Natarajan, G. 1977. Contribution à l'etude caryosystematique des especes de la garrigue languedocienne. These, Academie de Montpellier, France.
CCDB · ipcn-api-dl — Natarajan, G. 1978. In IOPB chromosome number reports LXII. Taxon 27: 519–535.
CCDB · ipcn-api-dl — Skalinska, M. 1974. Further studies in chromosome numbers of Polish angiosperms. X. Acta Biol. Cracov., Ser. Bot. 17: 133–164.
CCDB · ipcn-api-dl — Sopova, M. 1972. Cytological study in the genus Allium from Macedonia. God. Zborn. Biol. Prir.-Mat. Fak. Univ. Kiril & Metodij 24: 83–102.
CCDB · ipcn-api-dl — Vosa, C. G. 1977. Heterochromatic patterns and species relationship. Nucleus 20: 33–41.
CCDB · ipcn-api-dl — HINDAKOVA, M. 1976. In Index of chromosome numbers of Slovakian flora. Part 5. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 25: 1–18.
CCDB · ipcn-api-dl — Özhatay, N. 1993. Allium in Turkey: distribution, diversity, endemism and chromosome number. Pages 247--271 in H. Demiriz & N. Özhatay (eds.), 5th OPTIMA Meeting, Istanbul Univ. Press.
CCDB · ipcn-api-dl — Johnson, M. A. T. & N. Özhatay. 1996. Cytology of Allium section Allium. Pp. 17--40 in B. Mathew, A Review of Allium Section Allium. Royal Botanic Gardens, Kew.
CCDB · ipcn-api-dl — Astrom. 2003. Chromosome numbers of Allium scorodoprasum and A. vineale from SW Finland and W Ukraine. Ann. Bot. Fenn. 40: 1–3.
CCDB · ipcn-api-dl — Lippert. 2006. Chromosomenzahlen von Pflanzen aus Bayern und anderen Gebieten. Ber. Bayer. Bot. Ges. 76: 85–110.
CCDB · ipcn-api-dl — Cheshmedjiev, I. V. 1979. Karyosystematic investigations on species of the genus Allium L. in Bulgaria. Fitologija (Sofia). 11: 40–46.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · book-ipcn72 — SCRUGLI, A. 1972. In Numeri cromosomici per la flora Italiana. Informatore Bot. ItaY:- 4: 128-133.
CCDB · book-ipcn67-71 — DIETRICH, J. 1967. Genre Allium. Caryotypes de 46 especes en culture (Jardin botanique de Strasbourg). Inf. Ann. Caryosyst. et Cytogenet. 1: 23-26.
CCDB · book-ipcn67-71 — GADELLA, Th. W. J., & E. KLIPHUIS. 1967. Chromosome numbers of flowering plants in the Netherlands III. Proc. Roy. Neth. Acad. Sci. Ser. c. 70: 7-20.
CCDB · book-ipcn75-78 — Vosa 1977
+38 more references
2n 1629×CCDB · iber-fl · CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 +4
CCDB · iber-fl — Sobre a cariologia de algumas plantas da Serra do Geres. Fernandes, A.Agron. Lusit.12(4): 551-600(1950).
CCDB · ipcn-api-dl — Lovka, M. 1995. IOPB chromosome data 9. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 24: 21–23.
CCDB · ipcn-api-dl — Johnson, M. A. T. & P. E. Brandham. 1997. New chromosome numbers in petaloid monocotyledons and in other miscellaneous angiosperms. Kew Bull. 52(1): 121–138.
CCDB · ipcn-api-dl — Van Loon, J. C. & H. C. M. Snelders. 1979. In IOPB chromosome number reports LXV. Taxon 28: 632–634.
CCDB · ipcn-api-dl — Fernandez Casas, J., A. P. Sorolla & A. Susanna. 1980b. Numeros cromosomaticos de plantas occidentales, 64-69. Anales Jard. Bot. Madrid 37: 199–201.
CCDB · ipcn-api-dl — LOON VAN, J. C. & J. J. M. H. OUDEMANS. 1976. Chromosome numbers of some angiosperms of the southern USSR. Acta Bot. Neerl. 25: 329–336.
CCDB · ipcn-api-dl — Scrugli, A. & E. BOCCHIERI. 1977. Numeri cromosomici per la flora Italiana: 348-357. Inform. Bot. Ital. 9: 127–133.
CCDB · ipcn-api-dl — Sopova, M. 1972. Cytological study in the genus Allium from Macedonia. God. Zborn. Biol. Prir.-Mat. Fak. Univ. Kiril & Metodij 24: 83–102.
CCDB · ipcn-api-dl — Vosa, C. G. 1977. Heterochromatic patterns and species relationship. Nucleus 20: 33–41.
CCDB · ipcn-api-dl — Magulaev, A. J. 1976. The chromosome numbers of flowering plants of the Northern Caucasus. Fl. North. Caucasus 2: 51–62.
CCDB · ipcn-api-dl — Laan., F. M. V. 1979. In IOPB chromosome number reports LXV. Taxon 28: 636–637.
CCDB · book-ipcn67-71 — VON BOTHMER, R. 1970. Cytological studies in Allium L. Chromosome numbers and morphology in Allium, sect. Allium from Greece. Bot. Notiser 123: 518-SSO:--
CCDB · book-ipcn67-71 — MAJOVSKY, J., ET. AL. 1970. Index of chromosome numbers of Slovakian flora. (Part 2). Acta Fae. Rerum Nat. Univ. Comenianae Bot. 18: 45-60.
CCDB · book-ipcn67-71 — DIETRICH, J. 1967. Genre Allium. Caryotypes de 46 especes en culture (Jardin botanique de Strasbourg). Inf. Ann. Caryosyst. et Cytogenet. 1: 23-26.
CCDB · book-ipcn67-71 — CZESCHMEDJIEV, J.V. 1971. Cytosystematic study of some species from the genera Allium L. and Nectaroscordum Lindl. (in Russian) Bot. Zurn. 56: 1644-1657
CCDB · book-ipcn75-78 — Vos a 1977
CCDB · book-ipcn75-78 — Loon & Oudemans 1976
CCDB · book-ipcn75-78 — Sopova 1972
CCDB · book-ipcn75-78 — Magulaev 1976
CCDB · book-ipcn73-74 — BARROS NEVES, J. 1973. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47(Ser. 2}: 157 212.
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · book-fedorov — Levan 1929, 1931, 1935
CCDB · book-fedorov — Tschermak-Woess
CCDB · book-fedorov — Fernandes A. 1950b
CCDB · CromoCat 2015 — Fernandes, A. (1950a). Sobre a cariologia de algumas plantas da Serra do Gerês. Agron. Lusit. 12(4): 551-600.
CCDB · CromoCat 2015 — Loon van, J. C. & Snelders, H. M. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 627-637.
CCDB · CromoCat 2015 — Lovka, M. (1995). IOPB Chromosome Data 9 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 24: 21-23.
CCDB · CromoCat 2015 — Arends, J. C. & Van der Laan, F. M. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 636-637.
CCDB · CromoCat 2015 — Cesmedziev, I. (1974). Cytotaxonomical study of certain onion species of the section Allium. Compt. Rend. Acad. Bulg. Sci. 28: 1109-1112.
2n 4011×CCDB · iber-fl · CCDB · book-ipcn73-74 · CCDB · book-fedorov +2
CCDB · iber-fl — Herborizaoes nos domnios da fundaao da Casa de Bragana. I-Vendas Novas. Fernandes, A., J. Garcia & R. Fernandes.Mem. Soc. Brot.4: 5-89(1948).
CCDB · iber-fl — Karyology of Allium species from the Iberian peninsula. Pastor Daz, J.Phyton22(2): 171-200(1982).
CCDB · iber-fl — Contribution la connaissance cytotaxonomique des spermatophyta du Portugal. VIII. Liliaceae Barros Neves, J.Bol. Soc. Brot. ser. 247: 157-212(1973).
CCDB · book-ipcn73-74 — BARROS NEVES, J. 1973. Contribution a la connaissance cytotaxinomique des Spermatophyta du Portugal. VIII. Liliaceae. Bol. Soc. Brot. 47(Ser. 2}: 157 212.
CCDB · book-fedorov — Fernandes A. et al. 1948
CCDB · book-atlas-flowering-plants — Fernandes et al. '48
CCDB · CromoCat 2015 — Fernandes, A., Garcia, J. & Fernandes, R. (1948). Herborizaçoes nos domínios da fundaçao da Casa de Bragança. I-Vendas Novas. Mem. Soc. Brot. 4: 5-89.
CCDB · CromoCat 2015 — Pastor Díaz, J. (1982). Karyology of Allium species from the Iberian Peninsula. Phyton (Horn) 22(2): 171-200.
CCDB · CromoCat 2015 — Ved Brat, S. (1965a). Genetic systems in Allium I. Chromosome variation. Chromosoma 16: 486-499.
2n 483×CCDB · iber-fl · CCDB · CromoCat 2015
CCDB · iber-fl — Karyology of Allium species from the Iberian peninsula. Pastor Daz, J.Phyton22(2): 171-200(1982).
CCDB · CromoCat 2015 — Arends, J. C. & Van der Laan, F. M. (1979). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXV]. Taxon 28(5/6): 636-637.
CCDB · CromoCat 2015 — Pastor Díaz, J. (1982). Karyology of Allium species from the Iberian Peninsula. Phyton (Horn) 22(2): 171-200.
n 86×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Ruiz Rejon, M. 1976. In IOPB chromosome number reports LII. Taxon 25: 341–346.
CCDB · book-ipcn67-71 — DELAY, J. 1970. Polyploidie dans les peuplements naturals. Inf. Ann. Caryosyst. et Cytogenet. 4: 21-24.
CCDB · book-ipcn67-71 — DIETRICH, J. 1967. Genre Allium. Caryotypes de 46 especes en culture (Jardin botanique de Strasbourg). Inf. Ann. Caryosyst. et Cytogenet. 1: 23-26.
CCDB · book-ipcn67-71 — CZESCHMEDJIEV, J.V. 1971. Cytosystematic study of some species from the genera Allium L. and Nectaroscordum Lindl. (in Russian) Bot. Zurn. 56: 1644-1657
CCDB · book-ipcn75-78 — Ruiz Rejon 1976
n 163×CCDB · book-ipcn73-74 · CCDB · CromoCat 2015
CCDB · book-ipcn73-74 — CHESHMEDZHIEV, J.V. 1973. To the cytotaxonomy of some Bulgarian Allium L. species (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 864-87-5-.-----
CCDB · book-ipcn73-74 — LAANE, M.M. 1971. Chromosome number in Norwegian vascular plant species: 6. (in Norwegian). Blyttia 29: 229-234.
CCDB · CromoCat 2015 — Levan, A. (1931). Cytological studies in Allium. A preliminary note. Hereditas 15: 347-356.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type174 709 records
Wild obs. + sensor168 589
Museum / vouchered5 206
Cultivated / captive65
Other849
Origin
Native9 699
Introduced681
Range
Area of Occupancy AOO218 628 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy36% within 1 km
≤100 m 25 655≤1 km 24 215≤10 km 88 141>10 km 1 594
139 605 georeferenced · 28 984 without coordinates
Open the mapobservation + sensor168 589
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy53% within 1 km
≤100 m 567≤1 km 1 007≤10 km 1 260>10 km 125
2 959 georeferenced · 2 247 without coordinates
Open the institutions mapphysical evidence5 206
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
≤10 km 5>10 km 13
18 georeferenced · 47 without coordinates
Open the mapnot free-living65
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions141 of 248 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 543 |
| BIO-UNIPIlocation not on record | 312 |
| LDlocation not on record | 304 |
| Olocation not on record | 268 |
| BFLlocation not on record | 168 |
| Provincia di Livornolocation not on record | 161 |
| MeiseBGlocation not on record | 142 |
| Philadelphia, US | 129 |
| SLU Artdatabankenlocation not on record | 114 |
| Chongqing Museumlocation not on record | 107 |
| Uppsala, SE | 98 |
| KMNlocation not on record | 84 |
| BDBClocation not on record | 79 |
| Bergen, NO | 78 |
| Oskarshamn, SE | 76 |
| Bloomington, US | 67 |
| Adam Mickiewicz University in Poznańlocation not on record | 58 |
| Williamsburg, US | 58 |
| MAlocation not on record | 56 |
| Görlitz, DE | 56 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 51 |
| BRNUlocation not on record | 45 |
| Wuzhou, CN | 45 |
| Salzburg, AT | 43 |
| College Park, US | 42 |
| Adelaide, AU | 41 |
| University of Stellenboschlocation not on record | 41 |
| Trondheim, NO | 38 |
| BClocation not on record | 38 |
| València, ES | 38 |
| Auckland, NZ | 37 |
| South Kensington, GB | 37 |
| Entomological Society of Latvialocation not on record | 33 |
| Bangkok, TH | 31 |
| LfUlocation not on record | 29 |
| GJOlocation not on record | 29 |
| Saint Louis, US | 28 |
| Pullman, US | 28 |
| TUR-Alocation not on record | 27 |
| DBF-NHMDlocation not on record | 27 |
| New Haven, US | 26 |
| Barcelona, ES | 25 |
| Turku, FI | 25 |
| Bronx, US | 25 |
| Corvallis, US | 22 |
| WTUlocation not on record | 22 |
| Vitoria, ES | 21 |
| Dresden, DE | 21 |
| Canadian Department of Agriculturelocation not on record | 20 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 20 |
| Tartu, EE | 20 |
| Bern, CH | 18 |
| McWane Science Centerlocation not on record | 18 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 16 |
| Allentown, US | 16 |
| Kuopio, FI | 15 |
| Museo Entomologico de Leonlocation not on record | 15 |
| CJBGlocation not on record | 14 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 14 |
| Burlington, US | 14 |
| Jackson, US | 12 |
| Norfolk, US | 12 |
| Wlocation not on record | 12 |
| GAlocation not on record | 11 |
| Pamplona, ES | 11 |
| Chapel Hill, US | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Helsinki, FI | 10 |
| University of Tennessee at Chattanoogalocation not on record | 10 |
| Natural History Museum Rotterdamlocation not on record | 10 |
| CICYTEXlocation not on record | 10 |
| Ann Arbor, US | 10 |
| Mlocation not on record | 10 |
| Berlin, DE | 9 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 9 |
| Millersville, US | 9 |
| Knoxville, US | 9 |
| Salamanca, ES | 9 |
| Moscow State Universitylocation not on record | 9 |
| SWlocation not on record | 8 |
| Henderson State Universitylocation not on record | 8 |
| SZUlocation not on record | 8 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 7 |
| Hudson, US | 7 |
| Lord Fairfax Community Collegelocation not on record | 7 |
| Fulda, DE | 7 |
| Johnson City, US | 7 |
| Museum of the Rockieslocation not on record | 7 |
| Hobart, AU | 7 |
| Columbia, US | 7 |
| Oulu, FI | 6 |
| Clemson, US | 6 |
| Zürich, CH | 6 |
| Staten Island, US | 6 |
| Jyväskylä, FI | 6 |
| Fairfax, US | 6 |
| Frauenfeld, CH | 6 |
| Mississippi State, US | 6 |
| PRClocation not on record | 6 |
| Tallinn, EE | 6 |
| PrivatHerblocation not on record | 5 |
| Philadelphia, US | 5 |
| Philadelphia, US | 5 |
| Frankfurt am Main | 5 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 5 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 5 |
| Fort Worth, US | 5 |
| Tuscaloosa, US | 5 |
| Uniwersytet Warszawskilocation not on record | 5 |
| Davis, US | 5 |
| Madrid, ES | 4 |
| Badajoz, ES | 4 |
| Zürich, CH | 4 |
| Vancouver, CA | 4 |
| TROMlocation not on record | 4 |
| Wellington, NZ | 4 |
| Coimbra, PT | 4 |
| Western Carolina Universitylocation not on record | 4 |
| New Brunswick, US | 4 |
| JBSlocation not on record | 4 |
| John May Museum of Natural Historylocation not on record | 4 |
| Rotorua, NZ | 4 |
| AUAlocation not on record | 4 |
| Mohonk Preservelocation not on record | 4 |
| Little Rock, US | 3 |
| Dover, US | 3 |
| Conway, US | 3 |
| Logan, US | 3 |
| Xiamen, CN | 3 |
| Portland, US | 3 |
| Weber State Universitylocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Pamplona, ES | 3 |
| Long Beach, US | 3 |
| GZUlocation not on record | 3 |
| Bourges, FR | 3 |
| Uniwersytet Opolskilocation not on record | 3 |
| Springfield, US | 3 |
| Denver, US | 3 |
| H-Hohlalocation not on record | 3 |
| Kensington, AU | 3 |
| Porrentruy, CH | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| International Salmonella Centre (W.H.O.)location not on record | 3 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 3 |
| BSBIlocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| Pittsburg, US | 2 |
| Naturalis Biodiversity Centerlocation not on record | 2 |
| Tilburg, NL | 2 |
| Northridge, US | 2 |
| Provo, US | 2 |
| Finnish Museum of Natural History, Botanical Museumlocation not on record | 2 |
| Victoria, CA | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Bratislava, SK | 2 |
| Boumlocation not on record | 2 |
| Granada, ES | 2 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 2 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Dekalb, US | 2 |
| Tennessee Technological Universitylocation not on record | 2 |
| Salvador, BR | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Paris, FR | 2 |
| Tempe, US | 2 |
| Riverside, US | 2 |
| CASlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| BAYLUlocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Austin, US | 2 |
| Porvoo, FI | 2 |
| Due West, US | 2 |
| Canberra, AU | 2 |
| Christchurch, NZ | 2 |
| UIBlocation not on record | 2 |
| Podgorica, ME | 2 |
| Washington, US | 2 |
| Brisbane, AU | 2 |
| Flagstaff, US | 2 |
| Santa Barbara, US | 2 |
| Göteborg, SE | 2 |
| Moscow, US | 2 |
| Boise, US | 2 |
| Glarus, CH | 2 |
| H-AkrKGlocation not on record | 1 |
| Chicago, US | 1 |
| EL PASO, US | 1 |
| Fribourg, CH | 1 |
| Chadron, US | 1 |
| Tampa, US | 1 |
| Claremont, US | 1 |
| Emporia, US | 1 |
| CIBIOlocation not on record | 1 |
| Macomb, US | 1 |
| Université Lavallocation not on record | 1 |
| Fayetteville, US | 1 |
| Morgantown, US | 1 |
| OLAlocation not on record | 1 |
| No collectionlocation not on record | 1 |
| H-Dueringlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Whitehorse, CA | 1 |
| Richmond, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Mount Pleasant, US | 1 |
| Audubon Society -- Silver Bluff Audubon Center and Sanctuarylocation not on record | 1 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 1 |
| Kirksville, US | 1 |
| SNSNMClocation not on record | 1 |
| UNESP-FCAlocation not on record | 1 |
| Nijmegen, NL | 1 |
| LINUlocation not on record | 1 |
| Karlsruhe, DE | 1 |
| Lincoln, US | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| GB | 1 |
| UGentlocation not on record | 1 |
| Shrewsbury Schoollocation not on record | 1 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 1 |
| Lausanne, CH | 1 |
| Russellville, US | 1 |
| Museo Achille Folettolocation not on record | 1 |
| US | 1 |
| Hunan Geological Museumlocation not on record | 1 |
| Research Center in Biodiversity and Genetic Resourceslocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Davenport, US | 1 |
| Minia, EG | 1 |
| Monastir, TN | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Uniwersytet Śląski w Katowicachlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Durham, US | 1 |
| Kew, GB | 1 |
| Edmonton, CA | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Mount Annan, AU | 1 |
| H-Adlerlocation not on record | 1 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 1 |
| Madison, US | 1 |
| Córdoba, ES | 1 |
| ASUlocation not on record | 1 |
| Bothell, US | 1 |
| Montréal, CA | 1 |
248 institutions · 4 721 of 5 206 vouchered records shown · 419 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA121 detections
Where the DNA of Allium vineale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found121
Studies independent surveys2
Countries5
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 121 detections have coordinates
Open the map5 countries0
meadowIn deep grass.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.6 °C 10.8–16.9
Seasonal swing summer↔winter13.6 °C
Max temp (day)18.9 °C 14.1–21.6
Min temp (night)10.4 °C 6.90–12.8
Precipitation68.4 mm/mo 49.1–74.2
Air humidity60.3 % 56.8–64.0
Moisture balance-28.0 mm/mo
Vapour deficit675 Pa 493–867
Wind speed2.90 m/s
Cloud cover41.2 % 36.9–50.1
CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.