Allium tuberosum
Rottler ex Spreng. · speciesAt a glance
Occurrence records3 791
Data sources16
Biological traits21
DNA specimens33
eDNA detections33
Sources16 archives
Databases and archives Allium tuberosum's data was compiled from.
WikipediaWikimedia Foundation17 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility3 791 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI33 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics33 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
foodatlascompounds
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources21 traits
Chemical compositionFooDB · FoodAtlas · LOTUS · NPASS5 648 compounds
Occurrence & distributionGBIF3 791 records
Environmental DNA1 datasets · 2 countries33 detections
DNA & barcodingBOLD · NCBI33 specimens
Genome at a glanceCCDB · GoaT30.1 Gbp
01Narrative
Allium tuberosum (garlic chives, Oriental garlic, Asian chives, Chinese chives, Chinese leek) is a species of plant native to the Chinese province of Shanxi, and cultivated and naturalized elsewhere in Asia and around the world.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPTRYAusTraitsGIFT
Size & morphology4
Leaf width max8 mm
Leaf width min1.5 mm
Plant height0.3 m
Seed mass4.13 mg
Life cycle & reproduction7
Deciduousnessdeciduous
Life formbulbous geophyte
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formcryptophyte
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment6
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Woodinessnon-woody
Physiology & chemistry2
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits1
Plant support typefree-standing
03Chemical composition5 648 compounds
Compounds documented for Allium tuberosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingHerbs and Spices
Compound class profile5 classes
Aminoacids72
Glycerophospholipids57
Cinnamic acids and derivatives32
Purine nucleos(t)ides31
Monosaccharides27
Documented compounds5 648 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Kaempferol | 2.12 mg/100 g | FooDB | |
| Quercetin | 0.2 mg/100g | FooDB | |
| Myricetin | 0 mg/100g | FooDB |
05DNA & barcoding33 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allium tuberosum has left across the world's sequence archives.
At a glance
DNA specimens33
Marker genes4
GenBank sequences10
eDNA detections33
Countries2
The DNA barcodea real sequence read deposited for this species
GAGAACTTGTACCTATACCCATCGAGAACAAGGCAGTAATGCTATAAATATTGTATTGTTTAGAAGGGTTTCCCTTTGCTACCTTCTTCT …
Allium tuberosum voucher BGIR MDD1 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★ITS6★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT
The complete instruction manual Allium tuberosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size30 122 400 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
WHEAT17 Gb
THIS GENOME Allium tuberosum30.12 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidy4× tetraploid · measured
Chromosome records16–642n range32median32mode36records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3232×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Li, R. q. 1989. Studies on Karyotypes of Vegetables in China
CCDB · ipcn-api-dl — Xu, J. X., D. G. Luo & M. C. Jiang. 1985. Young leaves of Allium tuberosum are good materials for observing mitotic division. Guangxi Nongye Xueyuan Xuebao (J. Guangxi Agric. Coll.). (2): 24. (In Chinese).
CCDB · ipcn-api-dl — Zou, D. Q. & Q. Y. Jia. 1985. Cytological study on Chinese chive (Allium tuberosum Rottl.) and wild chive (A. ramosum) Hebei Nongye Daxue Xuebao (J. Hebei Agric. Univ.). 8(1): 12–17.
CCDB · ipcn-api-dl — Nanuscyan, E. R. & V. J. Polyakov. 1989. The dependence between the DNA content, the thickness of mitotic chromosomes and the volume of pollen grains in some species of genus Allium L. Biol. Nauki (Alma-Ata) 8: 50–56.
CCDB · ipcn-api-dl — Ohi, M. 1990. Studies on the factor of existence in Allium chinense guessed from elimination of the constitution of chromosomes. J. Fac. Agric. Shinshu Univ. 27: 49–90.
CCDB · ipcn-api-dl — Rao, S. R., R. Pandey & K. P. S. Chandel. 1992. Genetic stability studies in regenerated plants of Allium tuberosum Rottl. ex Spreng.---a cytological approach. Cytologia 57: 339–347.
CCDB · ipcn-api-dl — Li, R., L. Liu & X. Wang. 1985. Karyotype analysis on the different cultivars of Allium tuberosum Rottle. Chin. Bull. Bot. 3(5): 43–46.
CCDB · ipcn-api-dl — Shang, Z. y., R. j. Li, T. c. Cui & J. m. Xu. 1997. Studies on chromosomes of eight species of Allium from China. Acta Phytotax. Sin. 35(5): 434–444.
CCDB · ipcn-api-dl — Yan, L., L. y. Wang & H. Li. 1999. The chromosome number and karyotype analysis of 10 species of Allium from Neimongolia. Grassl. China 1999(5): 72–74.
CCDB · ipcn-api-dl — Zhang, C. s. 1998. A preliminary study on making plant chromosomal specimens using peppermint oil compound as pretreatment agent. J. Wuhan Bot. Res. 16(3): 280–282.
CCDB · ipcn-api-dl — Talukder, K. & S. SEN. 2000. Chromosome characteristics in some Allium spp. and assessment of their interrelationship. Nucleus (Calcutta) 43(1,2): 46–57.
CCDB · ipcn-api-dl — KAUL., R. 1981a. In Chromosome number reports LXXII. Taxon 30: 707.
CCDB · ipcn-api-dl — Banerjee, N. 1980. Chromosome studies in somes species of Allium. Proc. Indian Sci. Congr. Assoc. (IV, A) 67: 35.
CCDB · ipcn-api-dl — Ohri, D. & K. Pistrick. 2001. Phenology and genome size variation in Allium L.---a tight correlation?. Pl. Biol. (Stuttgart) 3: 654–660.
CCDB · ipcn-api-dl — Sharma. 2004. Chromosomal chimeras in the male track of Allium tuberosum Rottl. ex Spreng. Caryologia 57(2): 158–162.
CCDB · ipcn-api-dl — JACOBSEN, T. D. & M. Ownbey. 1977. In IOPB chromosome number reports LVI. Taxon 26: 257–274.
CCDB · ipcn-api-dl — KIM, J. H. 1974. The study on scattering of chromosomes in cells---Scattering of chromosomes by treatment with potassium ferricyanide solution under light. Korean J. Bot. 17: 113–117.
CCDB · book-ipcn75-78 — Kim 1974
CCDB · book-ipcn75-78 — Jacobsen & Ownbey 1977
CCDB · book-ipcn73-74 — GOHIL, R.N., & A.K. KOUL. 1973. some adaptive genetic-evolutionary processes accompanying polyploidy in the Indian Alliums. Bot. Notiser 126: 426-432.
CCDB · book-ipcn73-74 — KOUL, A.K., & R.N. GOHIL. 1973. Cytotaxonomical conspectus of the flora of Kashmir (1) Chromosome numbers of some common plants. Phyton (Horn) 15: 57-66.
CCDB · book-ipcn73-74 — SEN, S. 1973. Structural hybridity intra-and interspecific level in Liliales. Folia Biol. (Cracow) 21: 83-197.
CCDB · book-indian_vol2 — La Cour (D. 1945) ; Kurita, M. 1962 ; Mathur, M. & Tandon, S.L. 1965 ; Kumar, V. & Pahuja, A.N. 1967a ; Dietrich, J. 1972; Gohil, R. N. & Koul, A,K. 1973 ; Sen, S. 1974a ; Mehra, P.N. & Sachdeva, S.K. 1976b ; Gobi!, R.N. et al. 1977 ; Jacobsen, T.D. & Ownbey, M. 1977 ; Sea, B.-B. 1977 ; Mehra, P .N. & Pandita, T.K. 1979
CCDB · book-fedorov — La Cour (D. 1945)
CCDB · book-fedorov — Kurita 1962b (I. 1962)
CCDB · book-atlas-flowering-plants — La Cour 1945 *
CCDB · kew — Baranyi M, Greilhuber J. 1999. Genome size in Allium: In quest of reproducible data. Annals of Botany 83: 687-695.
CCDB · Cave1962 — Kurita 1962b
CCDB · Automatic manuscript search — S. Sharma,Maki Yamamoto and Y. Mukai. 2016. "Dual modified antiphospho (Ser10)-acetyl (Lys14)-histone H3 predominantly mark the pericentromeric chromatin during mitosis in monokinetic plants". Journal of Genetics 95:965-973.
2n 162×CCDB · book-ipcn65 · CCDB · Cave1962
CCDB · book-ipcn65 — Ohno 1964
CCDB · Cave1962 — Baksay 1956
2n 241×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Huang, R. f., R. c. Wei & Y. x. Yan. 1985. Discovery of spontaneous triploid of Allium tuberosum. J. Wuhan Bot. Res. 3: 429–431.
2n 311×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Gohil & Koul 1974
2n 641×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Kojima, A., K. Hinata & S. Noda. 1991. An improvement of squash method for cytological study of female meiosis in Allium tuberosum, Liliaceae. CIS Chromosome Inform. Serv. 50: 5–7.
n 165×CCDB · ipcn-api-dl · CCDB · book-ipcn72 · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Zou, D. Q. & Q. Y. Jia. 1985. Cytological study on Chinese chive (Allium tuberosum Rottl.) and wild chive (A. ramosum) Hebei Nongye Daxue Xuebao (J. Hebei Agric. Univ.). 8(1): 12–17.
CCDB · ipcn-api-dl — Banerjee, N. 1980. Chromosome studies in somes species of Allium. Proc. Indian Sci. Congr. Assoc. (IV, A) 67: 35.
CCDB · ipcn-api-dl — Mehra, P. N. & S. K. Sachdeva. 1976a. Cytological observations on some west Himalayan monocots. III. Alliaceae. Cytologia 41: 23–30.
CCDB · book-ipcn72 — DIETRICH, J. 1972. Genre Allium. Especes de collections (suite). Inf. Ann. Caryosyst. et Cytogenet. 6: 17-20.
CCDB · book-ipcn75-78 — Mehra & Sachdeva l 976a
n 82×CCDB · book-ipcn65 · CCDB · ipcn-api-dl
CCDB · book-ipcn65 — Ohno 1964
CCDB · ipcn-api-dl — Li, R., L. Liu & X. Wang. 1985. Karyotype analysis on the different cultivars of Allium tuberosum Rottle. Chin. Bull. Bot. 3(5): 43–46.
n -331×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sharma. 2004. Chromosomal chimeras in the male track of Allium tuberosum Rottl. ex Spreng. Caryologia 57(2): 158–162.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type3 791 records
Wild obs. + sensor2 612
Museum / vouchered1 091
Cultivated / captive60
Other28
Origin
Native5
Introduced51
Range
Area of Occupancy AOO10 060 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy90% within 1 km
≤100 m 1 693≤1 km 202≤10 km 81>10 km 122
2 098 georeferenced · 514 without coordinates
Open the mapobservation + sensor2 612
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy57% within 1 km
≤100 m 43≤1 km 35≤10 km 48>10 km 12
138 georeferenced · 953 without coordinates
Open the institutions mapphysical evidence1 091
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy2% within 1 km
≤1 km 1≤10 km 51>10 km 1
53 georeferenced · 7 without coordinates
Open the mapnot free-living60
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions72 of 134 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 190 |
| Yangling, CN | 83 |
| Odawara, JP | 70 |
| Chengdu, CN | 57 |
| Kochi, JP | 49 |
| Guangzhou, CN | 43 |
| Nagano City, JP | 34 |
| Shinshu Universitylocation not on record | 27 |
| Wuhan, CN | 24 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 21 |
| GMBAlocation not on record | 21 |
| Toyama, JP | 17 |
| SLU Artdatabankenlocation not on record | 16 |
| Bando, JP | 14 |
| Tokushima, JP | 13 |
| Chiba, JP | 13 |
| Tsukuba, JP | 12 |
| Sanda, JP | 11 |
| Guilin, CN | 11 |
| Kunming, CN | 10 |
| NSMKlocation not on record | 10 |
| Nanjing, CN | 9 |
| Sendai, JP | 9 |
| BIO-UNIPIlocation not on record | 9 |
| Ischia Marine Centrelocation not on record | 8 |
| Sagamihara, JP | 8 |
| Otaru, JP | 8 |
| Fukushima Universitylocation not on record | 7 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 7 |
| Ann Arbor, US | 7 |
| Strecker Museum, Baylor Universitylocation not on record | 7 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 7 |
| Moscow State Universitylocation not on record | 6 |
| Saint Louis, US | 6 |
| Auckland, NZ | 6 |
| J.F.Oberlin Universitylocation not on record | 5 |
| KURAlocation not on record | 5 |
| Pullman, US | 5 |
| Lanzhou, CN | 5 |
| Toyota city nature sanctuarylocation not on record | 5 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 4 |
| WNNUlocation not on record | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| Tomioka, JP | 4 |
| University of Stellenboschlocation not on record | 4 |
| Chongqing Natural History Museumlocation not on record | 4 |
| Xining, CN | 4 |
| WTUlocation not on record | 4 |
| GJOlocation not on record | 4 |
| Guangzhou, CN | 4 |
| Provincia di Livornolocation not on record | 3 |
| Kawasaki Shi Tama Ku, JP | 3 |
| LDlocation not on record | 3 |
| Osaka, JP | 3 |
| Madison, US | 3 |
| Royal Botanical Gardenslocation not on record | 3 |
| Kyoto Universitylocation not on record | 3 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 3 |
| KNAMlocation not on record | 3 |
| Chengdu, CN | 3 |
| Mount Annan, AU | 3 |
| Nagatoro-machi, Chichibu-gun, JP | 3 |
| DNSMlocation not on record | 3 |
| KR | 2 |
| Parthenon Tama History Museumlocation not on record | 2 |
| Brisbane, AU | 2 |
| Columbia, US | 2 |
| Kew, GB | 2 |
| BRNUlocation not on record | 2 |
| Wuhan, CN | 2 |
| Philadelphia, US | 2 |
| National Institute of Biological Resourceslocation not on record | 2 |
| Central China Normal Universitylocation not on record | 2 |
| Nishihara, JP | 2 |
| College Park, US | 2 |
| Zhejiang Museum of Natural Historylocation not on record | 2 |
| Christchurch, NZ | 2 |
| Changsha, CN | 2 |
| Millersville, US | 2 |
| Northridge, US | 2 |
| St. Augustine, TT | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Canberra, AU | 2 |
| Bronx, US | 2 |
| Taipei, TW | 2 |
| Jishou Universitylocation not on record | 2 |
| Dekalb, US | 2 |
| Denver, US | 1 |
| Albuquerque, US | 1 |
| HAWlocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| Minia, EG | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Hazara Universitylocation not on record | 1 |
| Frankfurt am Main | 1 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 1 |
| Chongqing Museumlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| St. Paul, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| MeiseBGlocation not on record | 1 |
| Vancouver, CA | 1 |
| Tampa, US | 1 |
| Berlin, DE | 1 |
| Urumqi, CN | 1 |
| Xian, CN | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Hangzhou, CN | 1 |
| Henderson State Universitylocation not on record | 1 |
| DBF-NHMDlocation not on record | 1 |
| KIWElocation not on record | 1 |
| Seoul, KR | 1 |
| BDBClocation not on record | 1 |
| JP | 1 |
| Shanxi Universitylocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Chapel Hill, US | 1 |
| Cambridge, US | 1 |
| Cambridge, US | 1 |
| Wuzhou, CN | 1 |
| Iwate Prefectural Museumlocation not on record | 1 |
| HUN003location not on record | 1 |
| Guiyang, CN | 1 |
| GBR006location not on record | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| Pelotas, BR | 1 |
| Oskarshamn, SE | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Hebei Normal Universitylocation not on record | 1 |
| Shanxi Institute of Biologylocation not on record | 1 |
| Edinburgh, GB | 1 |
| McWane Science Centerlocation not on record | 1 |
134 institutions · 1 049 of 1 091 vouchered records shown · 40 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA33 detections
Where the DNA of Allium tuberosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found33
Studies independent surveys1
Countries2
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 33 detections have coordinates
Open the map2 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.8 °C 13.7–23.9
Seasonal swing summer↔winter21.8 °C
Max temp (day)24.4 °C 19.6–29.2
Min temp (night)13.8 °C 9.30–18.2
Precipitation94.2 mm/mo 82.6–106
Air humidity54.7 % 52.5–56.8
Moisture balance-28.1 mm/mo -36.3–-19.8
Vapour deficit1,175 Pa 821–1,528
Wind speed3.80 m/s 2.20–5.40
Cloud cover31.0 % 26.4–35.5
CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.