Allium tripedale

Trautv. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Amaryllidaceae/Allium

At a glance

Occurrence records19

Data sources12

Biological traits16

DNA specimens1

eDNA detections1

Sources12 archives

Databases and archives Allium tripedale's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources16 traits

Chemical compositionLOTUS · NPASS10 compounds

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Allium tripedale is a species of wild onion native to the Caucasus (North + South), Iraq, Turkey, and northern Iran.Kew World Checklist of Selected Plant Families It is related to Allium siculum. It produces up to 30 pink-violet bell-shaped flowers per umbel.Trautvetter, Ernst Rudolf von. 1873. ii. 485. Trudy Imperatorskago S.-Peterburgskago Botaniceskago Sada. Acta Horti Petropolitani. St. PetersburgTraub, Hamilton Paul. 1963. Plant Life 23: 65, Nectaroscordum tripedale.Bornmüller, Joseph Friedrich Nicolaus. 1915. Beihefte zum Botanischen Centralblatt 33(2): 210, Nectaroscordum persicumBornmüller, Joseph Friedrich Nicolaus. 1911. Beihefte zum Botanischen Centralblatt 28: 513 Allium roseum subsp. persicumPacific Bulb Society, Allium Species Four, Allium tripedale

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height max0.9 m

Plant height min0.5 m

Seed mass5.52 mg

Life cycle & reproduction5

Flowering endJun

Flowering startJun

Life formbulbous geophyte

Life spanperennial

Raunkiær life formcryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTrock crevices

Woodinessnon-woody

Other traits1

Plant support typefree-standing

03Chemical composition10 compounds

Compounds documented for Allium tripedale across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Guaiane sesquiterpenoids8

Eudesmane sesquiterpenoids $ Germacrane sesquiterpenoids1

Aminoacids1

Documented compounds10 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Dehydrocostus lactone	present	NPASS
(2R)-2-amino-3-[(R)-[(E)-but-1-enyl]sulfinyl]propanoic acid	present	LOTUS
(3aS,5S,6aR,8S,9aR,9bS)-5-hydroxy-3,6,9-trimethylidene-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3aS,5S,6aR,9aR,9bS)-3,6,9-trimethylidene-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3aS,6aR,8S,9aR,9bS)-3,6,9-trimethylidene-8-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3aS,6aR,8S,9S,9aS,9bS)-9-hydroxy-9-methyl-3,6-dimethylidene-8-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3a,4,5,6a,7,8,9a,9b-octahydroazuleno[4,5-b]furan-2-one	present	NPASS
(3S,3aS,6aR,8S,9aR,9bS)-8-hydroxy-3-methyl-6,9-dimethylidene-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-2-one	present	NPASS
[(3S,3aS,6aR,8S,9aR,9bS)-3-methyl-6,9-dimethylidene-2-oxo-3a,4,5,6a,7,8,9a,9b-octahydro-3H-azuleno[4,5-b]furan-8-yl] 3-methylbutanoate	present	NPASS
Reynosin	present	NPASS
zaluzanin C isovalerate	present	NPASS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allium tripedale has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes2

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSHF934350.1 ↗652 bpArmenia

ACGT

TCGAGCCTCCCTTTAATAGATTGAGATTGTGTAGAATTACCCGTCAACTACAAGGTTGATTTGTAAGTGCACTCTACCTTCTTGATGGAT …

Allium tripedale genomic DNA containing ITS1, 5.8S rRNA gene and ITS2, specimen voucher GAT:6082

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Allium tripedale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode5records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 185×CCDB · ipcn-api-dl · CCDB · book-ipcn73-74 · CCDB · Automatic manuscript search

CCDB · ipcn-api-dl — Pogosian, A. I. 1981. Analiz morfologicheskikh parametrov khromosom nekotorykh kavkazskikh vidov roda Allium L. Dokl. Akad. Nauk Armjansk. SSR (Erevan). 7: 39–58.

CCDB · ipcn-api-dl — Pogosian, A. I. 1997. Chromosome numbers in some species of monocotyledons from the Transcaucasia. Bot. Žhurn. (Moscow & Leningrad) 82(6): 117–118.

CCDB · ipcn-api-dl — Persson, K. & P. Wendelbo. 1979a. The taxonomic position of Nectaroscordum koeizii (Liliaceae). Bot. Not. 132: 191–196.

CCDB · book-ipcn73-74 — POGOSYAN, A. I. 1974. Chromosome numbers in some species of flower inl' plants from the flora of the Aragatz Mountain Massif. (in Russian) Tsitologiya i Genetika 8: 449-451. I

CCDB · Automatic manuscript search — A. Dolatyari,Shahryar Saeidi Mehrvarz,S. A. Shahzadeh Fazeli,M. Naghavi and R. Fritsch. 2018. "Karyological studies of Iranian Allium L. (Amaryllidaceae) species with focus on sect. Acanthoprason. 1. Mitotic chromosomes". Plant Systematics and Evolution 304:583-606.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.943 ↗

08Occurrence & distribution

Record type19 records

Wild obs. + sensor10

Museum / vouchered9

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy71% within 1 km

≤100 m 2≤1 km 3≤10 km 2

7 georeferenced · 3 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wlocation not on record	3
Moscow State Universitylocation not on record	2
Kew, GB	1
Stadt Seeland, Ortsteil Gatersleben, DE	1
Berlin, DE	1

5 institutions · 8 of 9 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Allium tripedale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)