Allecula morio

(Fabricius, 1787) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Tenebrionidae/Allecula

At a glance

Occurrence records3 100

Data sources8

Biological traits0

DNA specimens32

eDNA detections55

Sources8 archives

Databases and archives Allecula morio's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 100 records

Environmental DNA1 datasets · 6 countries55 detections

DNA & barcodingBOLD32 specimens

01Narrative

Allecula morio is a species of beetle belonging to the family Tenebrionidae. It is native to Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Allecula morio has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections55

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.02%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

217Cmostly conserved

AACACTTTATTTCATCTTCGGAGCATGAGCCGGAATAGTAGGAACATCCCTCAGCCTACTAATTCGTGCAGAGCTCGGAAACCCAGGTTC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Stenomorpha tenuicollissame family15.7%Mycetochara quadrimaculatasame family16.3%Philharmostes ballerioisame order16.3%Ephalus latimanussame family16.4%Alobates barbatussame family16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type3 100 records

Wild obs. + sensor2 345

Museum / vouchered553

Cultivated / captive1

Other201

Origin

Native83

Range

Area of Occupancy AOO4 220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy66% within 1 km

≤100 m 1 094≤1 km 328≤10 km 725>10 km 12

2 159 georeferenced · 186 without coordinates

Open the mapobservation + sensor2 345

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy54% within 1 km

≤100 m 125≤1 km 102≤10 km 188>10 km 7

422 georeferenced · 131 without coordinates

Open the institutions mapphysical evidence553

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	204
Muzeum Górnośląskie w Bytomiulocation not on record	44
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	24
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	22
Provincia di Livornolocation not on record	21
Bonn, DE	20
Geneva, CH	19
NMOKlocation not on record	17
ZSMlocation not on record	12
Paro, BT	6
Helsinki, FI	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Zürich, CH	2
Salzburg, AT	2
Musée de l'Hospice du Grand-Saint-Bernardlocation not on record	2
Dhaka, BD	2
Tilburg, NL	2
Adam Mickiewicz University in Poznańlocation not on record	2
MZLUlocation not on record	2
Bern, CH	1
IFR-DNFlocation not on record	1
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	1

22 institutions · 412 of 553 vouchered records shown · 141 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA55 detections

Where the DNA of Allecula morio was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map6 countries0

aus trockenen und Mulmigen Rinden am FuÃ ei…HofgelÃ¤ndeaus weiÃfaulem Mulm in der FuÃhÃ¶hle einer…LaubwaldDRY GRASSLAND ON SANDaus Rinden und Mulm am FuÃ einer toten Alte…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 13.6–20.1

Seasonal swing summer↔winter17.1 °C

Max temp (day)22.5 °C 17.7–25.0

Min temp (night)13.6 °C 8.70–14.9

Precipitation73.1 mm/mo 61.7–81.0

Air humidity59.0 % 56.0–63.2

Moisture balance-55.4 mm/mo -62.8–-16.1

Vapour deficit878 Pa 651–1,032

Wind speed3.60 m/s 2.30–3.80

Cloud cover33.3 % 30.8–38.8

CHELSA 1981–2010, ~9 km grid, at location & month of 52 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Allecula morio

At a glance

Sources8 archives

At a glance

Record type3 100 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 22 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 100 records